Incidental Mutation 'R5790:Gigyf1'
ID448260
Institutional Source Beutler Lab
Gene Symbol Gigyf1
Ensembl Gene ENSMUSG00000029714
Gene NameGRB10 interacting GYF protein 1
SynonymsPerq1
MMRRC Submission 043384-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.518) question?
Stock #R5790 (G1)
Quality Score139
Status Validated
Chromosome5
Chromosomal Location137518548-137527935 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 137524255 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031726] [ENSMUST00000031727] [ENSMUST00000111020] [ENSMUST00000111023] [ENSMUST00000111027] [ENSMUST00000111038] [ENSMUST00000132525] [ENSMUST00000140139] [ENSMUST00000143495] [ENSMUST00000150063] [ENSMUST00000168746] [ENSMUST00000170293] [ENSMUST00000197624]
Predicted Effect probably benign
Transcript: ENSMUST00000031726
SMART Domains Protein: ENSMUSP00000031726
Gene: ENSMUSG00000029713

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
WD40 44 83 1.05e-7 SMART
WD40 86 125 3.96e-3 SMART
WD40 132 170 1.57e-6 SMART
WD40 173 212 2.98e-7 SMART
WD40 215 254 2.1e-7 SMART
WD40 257 298 1.72e-3 SMART
WD40 301 340 2.04e-5 SMART
Predicted Effect unknown
Transcript: ENSMUST00000031727
AA Change: P752S
SMART Domains Protein: ENSMUSP00000031727
Gene: ENSMUSG00000029714
AA Change: P752S

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
low complexity region 114 129 N/A INTRINSIC
low complexity region 253 269 N/A INTRINSIC
low complexity region 323 352 N/A INTRINSIC
low complexity region 360 379 N/A INTRINSIC
coiled coil region 424 450 N/A INTRINSIC
GYF 477 532 1.6e-25 SMART
low complexity region 534 543 N/A INTRINSIC
low complexity region 553 576 N/A INTRINSIC
low complexity region 597 613 N/A INTRINSIC
coiled coil region 671 735 N/A INTRINSIC
low complexity region 748 759 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
low complexity region 848 877 N/A INTRINSIC
low complexity region 881 893 N/A INTRINSIC
coiled coil region 957 984 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111020
SMART Domains Protein: ENSMUSP00000106649
Gene: ENSMUSG00000029713

DomainStartEndE-ValueType
WD40 1 39 2.65e-4 SMART
WD40 42 81 3.96e-3 SMART
WD40 88 126 1.57e-6 SMART
WD40 129 168 2.98e-7 SMART
WD40 171 210 2.1e-7 SMART
WD40 213 254 1.72e-3 SMART
WD40 257 296 2.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111023
SMART Domains Protein: ENSMUSP00000106652
Gene: ENSMUSG00000029713

DomainStartEndE-ValueType
WD40 1 39 2.65e-4 SMART
WD40 42 81 3.96e-3 SMART
WD40 88 126 1.57e-6 SMART
WD40 129 168 2.98e-7 SMART
WD40 171 210 2.1e-7 SMART
WD40 213 254 1.72e-3 SMART
WD40 257 296 2.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111027
SMART Domains Protein: ENSMUSP00000106656
Gene: ENSMUSG00000029713

DomainStartEndE-ValueType
low complexity region 23 41 N/A INTRINSIC
low complexity region 45 59 N/A INTRINSIC
WD40 86 125 1.05e-7 SMART
WD40 128 167 3.96e-3 SMART
WD40 174 212 1.57e-6 SMART
WD40 215 254 2.98e-7 SMART
WD40 257 296 2.1e-7 SMART
WD40 299 340 1.72e-3 SMART
WD40 343 382 2.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111038
SMART Domains Protein: ENSMUSP00000106667
Gene: ENSMUSG00000029711

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:EPO_TPO 30 191 2.8e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125868
Predicted Effect probably benign
Transcript: ENSMUST00000132525
SMART Domains Protein: ENSMUSP00000119725
Gene: ENSMUSG00000029713

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
WD40 44 83 1.05e-7 SMART
WD40 86 125 3.96e-3 SMART
WD40 132 170 1.57e-6 SMART
WD40 173 212 2.98e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140139
SMART Domains Protein: ENSMUSP00000121942
Gene: ENSMUSG00000029713

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
WD40 44 83 1.05e-7 SMART
WD40 86 125 3.96e-3 SMART
WD40 132 170 1.57e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142252
Predicted Effect probably benign
Transcript: ENSMUST00000143495
SMART Domains Protein: ENSMUSP00000126823
Gene: ENSMUSG00000029713

DomainStartEndE-ValueType
Pfam:WD40 1 25 3.8e-3 PFAM
WD40 32 70 1.57e-6 SMART
WD40 73 112 2.98e-7 SMART
WD40 115 154 2.1e-7 SMART
WD40 157 198 1.72e-3 SMART
WD40 201 240 2.04e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144667
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145238
Predicted Effect probably benign
Transcript: ENSMUST00000150063
SMART Domains Protein: ENSMUSP00000129353
Gene: ENSMUSG00000029713

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
WD40 44 83 1.05e-7 SMART
WD40 86 125 3.96e-3 SMART
WD40 132 170 1.57e-6 SMART
WD40 173 212 2.98e-7 SMART
WD40 215 254 2.1e-7 SMART
WD40 257 298 1.72e-3 SMART
WD40 301 340 2.04e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167225
Predicted Effect probably benign
Transcript: ENSMUST00000168746
SMART Domains Protein: ENSMUSP00000132908
Gene: ENSMUSG00000029713

DomainStartEndE-ValueType
Pfam:WD40 1 25 3.8e-3 PFAM
WD40 32 70 1.57e-6 SMART
WD40 73 112 2.98e-7 SMART
WD40 115 154 2.1e-7 SMART
WD40 157 198 1.72e-3 SMART
WD40 201 240 2.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170293
SMART Domains Protein: ENSMUSP00000128038
Gene: ENSMUSG00000029713

DomainStartEndE-ValueType
WD40 1 39 2.65e-4 SMART
WD40 42 81 3.96e-3 SMART
WD40 88 126 1.57e-6 SMART
WD40 129 168 2.98e-7 SMART
WD40 171 210 2.1e-7 SMART
WD40 213 254 1.72e-3 SMART
WD40 257 296 2.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197624
SMART Domains Protein: ENSMUSP00000143670
Gene: ENSMUSG00000029714

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
low complexity region 114 129 N/A INTRINSIC
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 99% (73/74)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 A T 5: 30,894,358 R633* probably null Het
Ahnak T C 19: 9,015,248 V4632A probably damaging Het
Asap1 T A 15: 64,094,265 D997V probably damaging Het
Atad2 T C 15: 58,126,594 Y162C probably damaging Het
Atp2b2 G T 6: 113,759,309 S936R probably damaging Het
Bcl11a T A 11: 24,163,650 L331Q probably damaging Het
C6 T A 15: 4,763,486 F358I probably damaging Het
Capn15 C T 17: 25,964,547 S386N probably benign Het
Ccdc66 G A 14: 27,500,447 T113I possibly damaging Het
Cd200 G T 16: 45,397,258 H23Q possibly damaging Het
Cdh17 A G 4: 11,814,945 probably null Het
Ces2b C T 8: 104,833,936 P128S probably damaging Het
Ces3b A T 8: 105,092,638 Q442L probably damaging Het
Chil4 T C 3: 106,202,578 H373R probably benign Het
Ciapin1 C A 8: 94,825,183 probably benign Het
Cnot10 A C 9: 114,625,917 probably null Het
Cpq A G 15: 33,249,997 K167E probably damaging Het
Dennd4b T A 3: 90,277,450 D1118E probably damaging Het
Dnah8 T A 17: 30,875,004 C4691S probably damaging Het
Dnajc1 A G 2: 18,307,087 probably benign Het
Dnhd1 G A 7: 105,655,774 R341H probably damaging Het
Dock10 G T 1: 80,505,170 T2145K probably benign Het
Eif3b T C 5: 140,442,131 V736A probably benign Het
Eno1 G T 4: 150,245,253 V195L probably benign Het
Ewsr1 C T 11: 5,082,263 probably benign Het
Fbn2 T C 18: 58,076,696 T1038A probably benign Het
Gabrb1 T C 5: 72,136,484 I367T possibly damaging Het
Glp2r T A 11: 67,764,799 Y39F probably damaging Het
Gm10036 T A 18: 15,833,186 Y131* probably null Het
Gm38706 T C 6: 130,484,998 noncoding transcript Het
Gna15 G A 10: 81,509,384 R216C probably damaging Het
Grin3a A G 4: 49,792,717 F339L probably damaging Het
Grk3 T G 5: 112,966,976 K126T possibly damaging Het
Hspa1l T C 17: 34,977,240 V85A probably benign Het
Iqsec1 A T 6: 90,689,880 L525* probably null Het
Irx3 T C 8: 91,799,676 T467A probably benign Het
Itga2 G A 13: 114,868,206 T530I probably benign Het
Lonp2 T C 8: 86,631,490 V113A probably benign Het
Msx3 C T 7: 140,048,953 R16H possibly damaging Het
Nek3 C A 8: 22,131,297 Q405H probably damaging Het
Nek3 T A 8: 22,131,298 Q403L probably damaging Het
Olfr11 T C 13: 21,638,876 T216A probably benign Het
Olfr798 A G 10: 129,625,888 Y58H probably damaging Het
P4ha1 A G 10: 59,354,362 N367S probably benign Het
Padi6 C A 4: 140,732,258 G429C probably damaging Het
Pidd1 T C 7: 141,441,392 probably benign Het
Plekhg5 T C 4: 152,113,935 V847A probably benign Het
Polr3e A G 7: 120,927,967 D56G probably damaging Het
Pomt2 T G 12: 87,127,378 N347T probably damaging Het
Ppp1r9a T C 6: 5,134,363 probably benign Het
Rbm33 A T 5: 28,339,298 D184V probably damaging Het
Rims2 A T 15: 39,681,045 T1431S probably damaging Het
Saal1 T C 7: 46,701,928 D208G probably damaging Het
Sis T C 3: 72,928,174 I952V probably benign Het
Slc30a1 T A 1: 191,908,885 D214E probably benign Het
Slc30a8 T C 15: 52,333,647 V318A possibly damaging Het
Smarca2 A G 19: 26,676,724 T770A probably damaging Het
Sptbn4 T A 7: 27,366,428 H2031L probably damaging Het
Ssbp1 A G 6: 40,480,870 S141G probably benign Het
Tgm4 A G 9: 123,061,743 E45G probably damaging Het
Thra T A 11: 98,762,951 S203T probably benign Het
Tle2 T C 10: 81,590,315 Y763H probably damaging Het
Tmem141 T A 2: 25,621,075 I102L probably benign Het
Tmem63c C T 12: 87,057,636 T77I probably benign Het
Tspo2 C A 17: 48,449,019 probably null Het
Ttc19 T A 11: 62,281,514 M1K probably null Het
Ucp1 A G 8: 83,297,891 N282D possibly damaging Het
Vmn1r33 A T 6: 66,612,214 F119I probably benign Het
Vmn2r24 A T 6: 123,815,540 M609L probably benign Het
Vwc2l A T 1: 70,750,983 H146L probably damaging Het
Other mutations in Gigyf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Gigyf1 APN 5 137522745 unclassified probably benign
IGL00326:Gigyf1 APN 5 137518948 utr 5 prime probably benign
IGL00935:Gigyf1 APN 5 137524834 missense possibly damaging 0.95
IGL01717:Gigyf1 APN 5 137525691 missense probably damaging 1.00
IGL02090:Gigyf1 APN 5 137525564 splice site probably null
IGL02354:Gigyf1 APN 5 137519727 splice site probably benign
IGL02361:Gigyf1 APN 5 137519727 splice site probably benign
IGL03370:Gigyf1 APN 5 137525690 missense possibly damaging 0.93
PIT4354001:Gigyf1 UTSW 5 137524104 missense unknown
R1415:Gigyf1 UTSW 5 137519216 splice site probably null
R1764:Gigyf1 UTSW 5 137522508 unclassified probably benign
R2259:Gigyf1 UTSW 5 137520332 missense possibly damaging 0.93
R2260:Gigyf1 UTSW 5 137520332 missense possibly damaging 0.93
R4656:Gigyf1 UTSW 5 137525215 nonsense probably null
R4717:Gigyf1 UTSW 5 137525232 missense probably damaging 1.00
R4732:Gigyf1 UTSW 5 137524770 missense probably benign 0.39
R4733:Gigyf1 UTSW 5 137524770 missense probably benign 0.39
R4942:Gigyf1 UTSW 5 137525690 missense possibly damaging 0.93
R5338:Gigyf1 UTSW 5 137523160 unclassified probably benign
R5503:Gigyf1 UTSW 5 137523467 unclassified probably benign
R5888:Gigyf1 UTSW 5 137525697 missense probably damaging 1.00
R5955:Gigyf1 UTSW 5 137523507 splice site probably null
R6544:Gigyf1 UTSW 5 137525059 missense probably damaging 1.00
R7227:Gigyf1 UTSW 5 137523823 missense unknown
Predicted Primers PCR Primer
(F):5'- TCAGTTTCAAGAGCGCAGAG -3'
(R):5'- CAAGCACTCCTGGAAACTGC -3'

Sequencing Primer
(F):5'- TTTCAAGAGCGCAGAGAAGTG -3'
(R):5'- TCCTGGAAACTGCGGCAGAG -3'
Posted On2016-12-15