Incidental Mutation 'R5790:P4ha1'
ID448285
Institutional Source Beutler Lab
Gene Symbol P4ha1
Ensembl Gene ENSMUSG00000019916
Gene Nameprocollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha 1 polypeptide
SynonymsP4ha
MMRRC Submission 043384-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5790 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location59323296-59373304 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59354362 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 367 (N367S)
Ref Sequence ENSEMBL: ENSMUSP00000009789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009789] [ENSMUST00000092512] [ENSMUST00000105466]
Predicted Effect probably benign
Transcript: ENSMUST00000009789
AA Change: N367S

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000009789
Gene: ENSMUSG00000019916
AA Change: N367S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:P4Ha_N 23 156 2e-47 PFAM
low complexity region 220 235 N/A INTRINSIC
P4Hc 335 518 2.2e-74 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092512
SMART Domains Protein: ENSMUSP00000090170
Gene: ENSMUSG00000019916

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:P4Ha_N 23 156 7.4e-48 PFAM
P4Hc 255 438 1.2e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105466
SMART Domains Protein: ENSMUSP00000101106
Gene: ENSMUSG00000019916

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:P4Ha_N 24 155 2.1e-42 PFAM
low complexity region 220 235 N/A INTRINSIC
P4Hc 335 518 1.2e-75 SMART
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of prolyl 4-hydroxylase, a key enzyme in collagen synthesis composed of two identical alpha subunits and two beta subunits. The encoded protein is one of several different types of alpha subunits and provides the major part of the catalytic site of the active enzyme. In collagen and related proteins, prolyl 4-hydroxylase catalyzes the formation of 4-hydroxyproline that is essential to the proper three-dimensional folding of newly synthesized procollagen chains. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, capillary ruptures, and impaired basement membrane formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 A T 5: 30,894,358 R633* probably null Het
Ahnak T C 19: 9,015,248 V4632A probably damaging Het
Asap1 T A 15: 64,094,265 D997V probably damaging Het
Atad2 T C 15: 58,126,594 Y162C probably damaging Het
Atp2b2 G T 6: 113,759,309 S936R probably damaging Het
Bcl11a T A 11: 24,163,650 L331Q probably damaging Het
C6 T A 15: 4,763,486 F358I probably damaging Het
Capn15 C T 17: 25,964,547 S386N probably benign Het
Ccdc66 G A 14: 27,500,447 T113I possibly damaging Het
Cd200 G T 16: 45,397,258 H23Q possibly damaging Het
Cdh17 A G 4: 11,814,945 probably null Het
Ces2b C T 8: 104,833,936 P128S probably damaging Het
Ces3b A T 8: 105,092,638 Q442L probably damaging Het
Chil4 T C 3: 106,202,578 H373R probably benign Het
Ciapin1 C A 8: 94,825,183 probably benign Het
Cnot10 A C 9: 114,625,917 probably null Het
Cpq A G 15: 33,249,997 K167E probably damaging Het
Dennd4b T A 3: 90,277,450 D1118E probably damaging Het
Dnah8 T A 17: 30,875,004 C4691S probably damaging Het
Dnajc1 A G 2: 18,307,087 probably benign Het
Dnhd1 G A 7: 105,655,774 R341H probably damaging Het
Dock10 G T 1: 80,505,170 T2145K probably benign Het
Eif3b T C 5: 140,442,131 V736A probably benign Het
Eno1 G T 4: 150,245,253 V195L probably benign Het
Ewsr1 C T 11: 5,082,263 probably benign Het
Fbn2 T C 18: 58,076,696 T1038A probably benign Het
Gabrb1 T C 5: 72,136,484 I367T possibly damaging Het
Gigyf1 C T 5: 137,524,255 probably benign Het
Glp2r T A 11: 67,764,799 Y39F probably damaging Het
Gm10036 T A 18: 15,833,186 Y131* probably null Het
Gm38706 T C 6: 130,484,998 noncoding transcript Het
Gna15 G A 10: 81,509,384 R216C probably damaging Het
Grin3a A G 4: 49,792,717 F339L probably damaging Het
Grk3 T G 5: 112,966,976 K126T possibly damaging Het
Hspa1l T C 17: 34,977,240 V85A probably benign Het
Iqsec1 A T 6: 90,689,880 L525* probably null Het
Irx3 T C 8: 91,799,676 T467A probably benign Het
Itga2 G A 13: 114,868,206 T530I probably benign Het
Lonp2 T C 8: 86,631,490 V113A probably benign Het
Msx3 C T 7: 140,048,953 R16H possibly damaging Het
Nek3 C A 8: 22,131,297 Q405H probably damaging Het
Nek3 T A 8: 22,131,298 Q403L probably damaging Het
Olfr11 T C 13: 21,638,876 T216A probably benign Het
Olfr798 A G 10: 129,625,888 Y58H probably damaging Het
Padi6 C A 4: 140,732,258 G429C probably damaging Het
Pidd1 T C 7: 141,441,392 probably benign Het
Plekhg5 T C 4: 152,113,935 V847A probably benign Het
Polr3e A G 7: 120,927,967 D56G probably damaging Het
Pomt2 T G 12: 87,127,378 N347T probably damaging Het
Ppp1r9a T C 6: 5,134,363 probably benign Het
Rbm33 A T 5: 28,339,298 D184V probably damaging Het
Rims2 A T 15: 39,681,045 T1431S probably damaging Het
Saal1 T C 7: 46,701,928 D208G probably damaging Het
Sis T C 3: 72,928,174 I952V probably benign Het
Slc30a1 T A 1: 191,908,885 D214E probably benign Het
Slc30a8 T C 15: 52,333,647 V318A possibly damaging Het
Smarca2 A G 19: 26,676,724 T770A probably damaging Het
Sptbn4 T A 7: 27,366,428 H2031L probably damaging Het
Ssbp1 A G 6: 40,480,870 S141G probably benign Het
Tgm4 A G 9: 123,061,743 E45G probably damaging Het
Thra T A 11: 98,762,951 S203T probably benign Het
Tle2 T C 10: 81,590,315 Y763H probably damaging Het
Tmem141 T A 2: 25,621,075 I102L probably benign Het
Tmem63c C T 12: 87,057,636 T77I probably benign Het
Tspo2 C A 17: 48,449,019 probably null Het
Ttc19 T A 11: 62,281,514 M1K probably null Het
Ucp1 A G 8: 83,297,891 N282D possibly damaging Het
Vmn1r33 A T 6: 66,612,214 F119I probably benign Het
Vmn2r24 A T 6: 123,815,540 M609L probably benign Het
Vwc2l A T 1: 70,750,983 H146L probably damaging Het
Other mutations in P4ha1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:P4ha1 APN 10 59339335 missense probably damaging 1.00
IGL01820:P4ha1 APN 10 59361914 missense probably damaging 1.00
IGL02340:P4ha1 APN 10 59352201 missense probably benign 0.03
IGL02480:P4ha1 APN 10 59343752 missense probably damaging 1.00
IGL02496:P4ha1 APN 10 59371002 critical splice acceptor site probably null
PIT4453001:P4ha1 UTSW 10 59350472 missense probably benign
R0149:P4ha1 UTSW 10 59348399 missense probably damaging 1.00
R0265:P4ha1 UTSW 10 59348259 missense probably damaging 1.00
R0282:P4ha1 UTSW 10 59337148 missense probably damaging 1.00
R0432:P4ha1 UTSW 10 59348257 nonsense probably null
R0683:P4ha1 UTSW 10 59337147 missense probably benign 0.05
R1929:P4ha1 UTSW 10 59371037 missense probably damaging 1.00
R5858:P4ha1 UTSW 10 59339378 missense probably damaging 1.00
R5955:P4ha1 UTSW 10 59342796 missense probably benign 0.00
R6123:P4ha1 UTSW 10 59350527 missense possibly damaging 0.80
R7237:P4ha1 UTSW 10 59348243 missense probably benign
X0062:P4ha1 UTSW 10 59348246 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TTTCAAGGCGCGACACAAG -3'
(R):5'- CTTCTAGTCAAGGGAAAACCCGTG -3'

Sequencing Primer
(F):5'- GCGCGACACAAGGTGATTG -3'
(R):5'- ATTCACGCACTGCTCTGGAG -3'
Posted On2016-12-15