Incidental Mutation 'R5790:Ttc19'
ID448291
Institutional Source Beutler Lab
Gene Symbol Ttc19
Ensembl Gene ENSMUSG00000042298
Gene Nametetratricopeptide repeat domain 19
Synonyms
MMRRC Submission 043384-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R5790 (G1)
Quality Score134
Status Not validated
Chromosome11
Chromosomal Location62281473-62328451 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 62281514 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000098636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050646] [ENSMUST00000072916] [ENSMUST00000101075]
Predicted Effect probably null
Transcript: ENSMUST00000050646
AA Change: M1K
SMART Domains Protein: ENSMUSP00000054367
Gene: ENSMUSG00000042298
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 3 29 N/A INTRINSIC
low complexity region 77 86 N/A INTRINSIC
Blast:TPR 87 120 9e-6 BLAST
Blast:TPR 128 160 1e-9 BLAST
Pfam:TPR_12 216 301 1.1e-14 PFAM
Pfam:TPR_10 226 267 2.4e-6 PFAM
Pfam:TPR_10 307 339 5.4e-6 PFAM
Pfam:TPR_2 308 339 8.2e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072916
SMART Domains Protein: ENSMUSP00000072688
Gene: ENSMUSG00000014243

DomainStartEndE-ValueType
Pfam:SWIM 66 114 1.7e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000101075
AA Change: M1K
SMART Domains Protein: ENSMUSP00000098636
Gene: ENSMUSG00000042298
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 3 29 N/A INTRINSIC
low complexity region 77 86 N/A INTRINSIC
Blast:TPR 87 120 9e-6 BLAST
Pfam:TPR_12 210 288 1.8e-14 PFAM
Pfam:TPR_10 213 254 3.4e-6 PFAM
Pfam:TPR_10 255 293 2e-3 PFAM
Pfam:TPR_10 294 327 3.7e-5 PFAM
Pfam:TPR_2 295 326 8e-5 PFAM
Pfam:TPR_1 296 326 8.7e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136477
Predicted Effect probably benign
Transcript: ENSMUST00000162385
SMART Domains Protein: ENSMUSP00000125618
Gene: ENSMUSG00000042298

DomainStartEndE-ValueType
Blast:TPR 8 40 4e-10 BLAST
Pfam:TPR_12 97 181 6.3e-15 PFAM
Pfam:TPR_10 106 147 2e-6 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a tetratricopeptide repeat (TPR) domain containing several TPRs of about 34 aa each. These repeats are found in a variety of organisms including bacteria, fungi and plants, and are involved in a variety of functions including protein-protein interactions. This protein is embedded in the inner mitochondrial membrane and is involved in the formation of the mitochondrial respiratory chain III. It has also been suggested that this protein plays a role in cytokinesis. Mutations in this gene cause mitochondrial complex III deficiency. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 A T 5: 30,894,358 R633* probably null Het
Ahnak T C 19: 9,015,248 V4632A probably damaging Het
Asap1 T A 15: 64,094,265 D997V probably damaging Het
Atad2 T C 15: 58,126,594 Y162C probably damaging Het
Atp2b2 G T 6: 113,759,309 S936R probably damaging Het
Bcl11a T A 11: 24,163,650 L331Q probably damaging Het
C6 T A 15: 4,763,486 F358I probably damaging Het
Capn15 C T 17: 25,964,547 S386N probably benign Het
Ccdc66 G A 14: 27,500,447 T113I possibly damaging Het
Cd200 G T 16: 45,397,258 H23Q possibly damaging Het
Cdh17 A G 4: 11,814,945 probably null Het
Ces2b C T 8: 104,833,936 P128S probably damaging Het
Ces3b A T 8: 105,092,638 Q442L probably damaging Het
Chil4 T C 3: 106,202,578 H373R probably benign Het
Ciapin1 C A 8: 94,825,183 probably benign Het
Cnot10 A C 9: 114,625,917 probably null Het
Cpq A G 15: 33,249,997 K167E probably damaging Het
Dennd4b T A 3: 90,277,450 D1118E probably damaging Het
Dnah8 T A 17: 30,875,004 C4691S probably damaging Het
Dnajc1 A G 2: 18,307,087 probably benign Het
Dnhd1 G A 7: 105,655,774 R341H probably damaging Het
Dock10 G T 1: 80,505,170 T2145K probably benign Het
Eif3b T C 5: 140,442,131 V736A probably benign Het
Eno1 G T 4: 150,245,253 V195L probably benign Het
Ewsr1 C T 11: 5,082,263 probably benign Het
Fbn2 T C 18: 58,076,696 T1038A probably benign Het
Gabrb1 T C 5: 72,136,484 I367T possibly damaging Het
Gigyf1 C T 5: 137,524,255 probably benign Het
Glp2r T A 11: 67,764,799 Y39F probably damaging Het
Gm10036 T A 18: 15,833,186 Y131* probably null Het
Gm38706 T C 6: 130,484,998 noncoding transcript Het
Gna15 G A 10: 81,509,384 R216C probably damaging Het
Grin3a A G 4: 49,792,717 F339L probably damaging Het
Grk3 T G 5: 112,966,976 K126T possibly damaging Het
Hspa1l T C 17: 34,977,240 V85A probably benign Het
Iqsec1 A T 6: 90,689,880 L525* probably null Het
Irx3 T C 8: 91,799,676 T467A probably benign Het
Itga2 G A 13: 114,868,206 T530I probably benign Het
Lonp2 T C 8: 86,631,490 V113A probably benign Het
Msx3 C T 7: 140,048,953 R16H possibly damaging Het
Nek3 C A 8: 22,131,297 Q405H probably damaging Het
Nek3 T A 8: 22,131,298 Q403L probably damaging Het
Olfr11 T C 13: 21,638,876 T216A probably benign Het
Olfr798 A G 10: 129,625,888 Y58H probably damaging Het
P4ha1 A G 10: 59,354,362 N367S probably benign Het
Padi6 C A 4: 140,732,258 G429C probably damaging Het
Pidd1 T C 7: 141,441,392 probably benign Het
Plekhg5 T C 4: 152,113,935 V847A probably benign Het
Polr3e A G 7: 120,927,967 D56G probably damaging Het
Pomt2 T G 12: 87,127,378 N347T probably damaging Het
Ppp1r9a T C 6: 5,134,363 probably benign Het
Rbm33 A T 5: 28,339,298 D184V probably damaging Het
Rims2 A T 15: 39,681,045 T1431S probably damaging Het
Saal1 T C 7: 46,701,928 D208G probably damaging Het
Sis T C 3: 72,928,174 I952V probably benign Het
Slc30a1 T A 1: 191,908,885 D214E probably benign Het
Slc30a8 T C 15: 52,333,647 V318A possibly damaging Het
Smarca2 A G 19: 26,676,724 T770A probably damaging Het
Sptbn4 T A 7: 27,366,428 H2031L probably damaging Het
Ssbp1 A G 6: 40,480,870 S141G probably benign Het
Tgm4 A G 9: 123,061,743 E45G probably damaging Het
Thra T A 11: 98,762,951 S203T probably benign Het
Tle2 T C 10: 81,590,315 Y763H probably damaging Het
Tmem141 T A 2: 25,621,075 I102L probably benign Het
Tmem63c C T 12: 87,057,636 T77I probably benign Het
Tspo2 C A 17: 48,449,019 probably null Het
Ucp1 A G 8: 83,297,891 N282D possibly damaging Het
Vmn1r33 A T 6: 66,612,214 F119I probably benign Het
Vmn2r24 A T 6: 123,815,540 M609L probably benign Het
Vwc2l A T 1: 70,750,983 H146L probably damaging Het
Other mutations in Ttc19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02024:Ttc19 APN 11 62313113 missense probably damaging 1.00
R0091:Ttc19 UTSW 11 62309084 missense probably damaging 1.00
R1929:Ttc19 UTSW 11 62281824 missense probably benign 0.21
R2291:Ttc19 UTSW 11 62283693 missense probably damaging 1.00
R4290:Ttc19 UTSW 11 62285927 intron probably null
R4681:Ttc19 UTSW 11 62309091 nonsense probably null
R4824:Ttc19 UTSW 11 62309096 missense probably benign 0.32
R5411:Ttc19 UTSW 11 62284151 missense probably benign 0.06
R6984:Ttc19 UTSW 11 62314037 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGGGACATAACCATGCG -3'
(R):5'- TTCAGCAGCTGGATGATCTCG -3'

Sequencing Primer
(F):5'- CAGGCCGTACTTCTCGC -3'
(R):5'- AGCTGGATGATCTCGGCCTC -3'
Posted On2016-12-15