Incidental Mutation 'R5790:Thra'
ID448293
Institutional Source Beutler Lab
Gene Symbol Thra
Ensembl Gene ENSMUSG00000058756
Gene Namethyroid hormone receptor alpha
SynonymsTR alpha 1, Thra2, Thra1, Rvr, TR alpha 2, c-erbAalpha, 6430529J03Rik, Erba, Nr1a1, T3Ralpha, T3R[a]
MMRRC Submission 043384-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #R5790 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location98740638-98769006 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 98762951 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 203 (S203T)
Ref Sequence ENSEMBL: ENSMUSP00000099428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064187] [ENSMUST00000064941] [ENSMUST00000103139] [ENSMUST00000124072]
Predicted Effect probably benign
Transcript: ENSMUST00000064187
AA Change: S203T

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000068281
Gene: ENSMUSG00000058756
AA Change: S203T

DomainStartEndE-ValueType
ZnF_C4 50 123 3.09e-36 SMART
HOLI 220 378 1.43e-31 SMART
low complexity region 461 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064941
SMART Domains Protein: ENSMUSP00000069505
Gene: ENSMUSG00000020889

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
low complexity region 70 94 N/A INTRINSIC
ZnF_C4 130 202 5.54e-38 SMART
low complexity region 240 263 N/A INTRINSIC
PDB:3N00|A 282 361 2e-21 PDB
HOLI 442 600 4.2e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103139
AA Change: S203T

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099428
Gene: ENSMUSG00000058756
AA Change: S203T

DomainStartEndE-ValueType
ZnF_C4 50 123 3.09e-36 SMART
HOLI 220 378 7.26e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124072
AA Change: S203T

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000115323
Gene: ENSMUSG00000058756
AA Change: S203T

DomainStartEndE-ValueType
ZnF_C4 50 123 3.09e-36 SMART
HOLI 220 378 2.36e-32 SMART
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: The protein encoded by this gene is one of several nuclear hormone receptors that bind thyroid hormones such as triiodothyronine and thyroxine with high affinity. The encoded protein is a transcription factor that can activate or repress transcription. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutations in this gene result in diverse phenotypes depending on the location and severity of the mutation. Observed phenotypes may include alterations in thyroid physiology, intestinal remodeling, cerebellum development, bone growth, cardiac function, thermogenesis, and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 A T 5: 30,894,358 R633* probably null Het
Ahnak T C 19: 9,015,248 V4632A probably damaging Het
Asap1 T A 15: 64,094,265 D997V probably damaging Het
Atad2 T C 15: 58,126,594 Y162C probably damaging Het
Atp2b2 G T 6: 113,759,309 S936R probably damaging Het
Bcl11a T A 11: 24,163,650 L331Q probably damaging Het
C6 T A 15: 4,763,486 F358I probably damaging Het
Capn15 C T 17: 25,964,547 S386N probably benign Het
Ccdc66 G A 14: 27,500,447 T113I possibly damaging Het
Cd200 G T 16: 45,397,258 H23Q possibly damaging Het
Cdh17 A G 4: 11,814,945 probably null Het
Ces2b C T 8: 104,833,936 P128S probably damaging Het
Ces3b A T 8: 105,092,638 Q442L probably damaging Het
Chil4 T C 3: 106,202,578 H373R probably benign Het
Ciapin1 C A 8: 94,825,183 probably benign Het
Cnot10 A C 9: 114,625,917 probably null Het
Cpq A G 15: 33,249,997 K167E probably damaging Het
Dennd4b T A 3: 90,277,450 D1118E probably damaging Het
Dnah8 T A 17: 30,875,004 C4691S probably damaging Het
Dnajc1 A G 2: 18,307,087 probably benign Het
Dnhd1 G A 7: 105,655,774 R341H probably damaging Het
Dock10 G T 1: 80,505,170 T2145K probably benign Het
Eif3b T C 5: 140,442,131 V736A probably benign Het
Eno1 G T 4: 150,245,253 V195L probably benign Het
Ewsr1 C T 11: 5,082,263 probably benign Het
Fbn2 T C 18: 58,076,696 T1038A probably benign Het
Gabrb1 T C 5: 72,136,484 I367T possibly damaging Het
Gigyf1 C T 5: 137,524,255 probably benign Het
Glp2r T A 11: 67,764,799 Y39F probably damaging Het
Gm10036 T A 18: 15,833,186 Y131* probably null Het
Gm38706 T C 6: 130,484,998 noncoding transcript Het
Gna15 G A 10: 81,509,384 R216C probably damaging Het
Grin3a A G 4: 49,792,717 F339L probably damaging Het
Grk3 T G 5: 112,966,976 K126T possibly damaging Het
Hspa1l T C 17: 34,977,240 V85A probably benign Het
Iqsec1 A T 6: 90,689,880 L525* probably null Het
Irx3 T C 8: 91,799,676 T467A probably benign Het
Itga2 G A 13: 114,868,206 T530I probably benign Het
Lonp2 T C 8: 86,631,490 V113A probably benign Het
Msx3 C T 7: 140,048,953 R16H possibly damaging Het
Nek3 C A 8: 22,131,297 Q405H probably damaging Het
Nek3 T A 8: 22,131,298 Q403L probably damaging Het
Olfr11 T C 13: 21,638,876 T216A probably benign Het
Olfr798 A G 10: 129,625,888 Y58H probably damaging Het
P4ha1 A G 10: 59,354,362 N367S probably benign Het
Padi6 C A 4: 140,732,258 G429C probably damaging Het
Pidd1 T C 7: 141,441,392 probably benign Het
Plekhg5 T C 4: 152,113,935 V847A probably benign Het
Polr3e A G 7: 120,927,967 D56G probably damaging Het
Pomt2 T G 12: 87,127,378 N347T probably damaging Het
Ppp1r9a T C 6: 5,134,363 probably benign Het
Rbm33 A T 5: 28,339,298 D184V probably damaging Het
Rims2 A T 15: 39,681,045 T1431S probably damaging Het
Saal1 T C 7: 46,701,928 D208G probably damaging Het
Sis T C 3: 72,928,174 I952V probably benign Het
Slc30a1 T A 1: 191,908,885 D214E probably benign Het
Slc30a8 T C 15: 52,333,647 V318A possibly damaging Het
Smarca2 A G 19: 26,676,724 T770A probably damaging Het
Sptbn4 T A 7: 27,366,428 H2031L probably damaging Het
Ssbp1 A G 6: 40,480,870 S141G probably benign Het
Tgm4 A G 9: 123,061,743 E45G probably damaging Het
Tle2 T C 10: 81,590,315 Y763H probably damaging Het
Tmem141 T A 2: 25,621,075 I102L probably benign Het
Tmem63c C T 12: 87,057,636 T77I probably benign Het
Tspo2 C A 17: 48,449,019 probably null Het
Ttc19 T A 11: 62,281,514 M1K probably null Het
Ucp1 A G 8: 83,297,891 N282D possibly damaging Het
Vmn1r33 A T 6: 66,612,214 F119I probably benign Het
Vmn2r24 A T 6: 123,815,540 M609L probably benign Het
Vwc2l A T 1: 70,750,983 H146L probably damaging Het
Other mutations in Thra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Thra APN 11 98762928 missense possibly damaging 0.90
IGL01544:Thra APN 11 98756928 missense possibly damaging 0.46
IGL02377:Thra APN 11 98761916 missense probably damaging 1.00
IGL02738:Thra APN 11 98764359 missense probably benign 0.40
IGL03111:Thra APN 11 98761029 unclassified probably benign
R0033:Thra UTSW 11 98764352 missense probably benign 0.00
R0033:Thra UTSW 11 98764352 missense probably benign 0.00
R0959:Thra UTSW 11 98753629 missense possibly damaging 0.94
R1659:Thra UTSW 11 98756979 missense probably damaging 0.99
R1839:Thra UTSW 11 98756143 missense probably benign 0.01
R1859:Thra UTSW 11 98756151 missense probably damaging 0.98
R1935:Thra UTSW 11 98763073 splice site probably benign
R1956:Thra UTSW 11 98763741 missense probably benign 0.03
R4584:Thra UTSW 11 98764484 missense probably benign 0.42
R4782:Thra UTSW 11 98756164 missense probably benign 0.01
R5414:Thra UTSW 11 98760957 missense probably benign 0.34
R5927:Thra UTSW 11 98763688 missense possibly damaging 0.56
R7207:Thra UTSW 11 98760976 missense probably damaging 1.00
R7234:Thra UTSW 11 98763718 missense probably damaging 1.00
R7307:Thra UTSW 11 98764308 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTCCCCTAATGTTGAAGCCTTG -3'
(R):5'- AGAAGAATACCCAGTGAGGCTC -3'

Sequencing Primer
(F):5'- CCTTGAGGCAGAGGCAGAGC -3'
(R):5'- AATACCCAGTGAGGCTCTGTGAC -3'
Posted On2016-12-15