Incidental Mutation 'R5790:Pomt2'
ID448295
Institutional Source Beutler Lab
Gene Symbol Pomt2
Ensembl Gene ENSMUSG00000034126
Gene Nameprotein-O-mannosyltransferase 2
SynonymsA830009D15Rik
MMRRC Submission 043384-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5790 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location87106861-87147968 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 87127378 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 347 (N347T)
Ref Sequence ENSEMBL: ENSMUSP00000152370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037788] [ENSMUST00000222634]
Predicted Effect probably damaging
Transcript: ENSMUST00000037788
AA Change: N417T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035260
Gene: ENSMUSG00000034126
AA Change: N417T

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:PMT 132 376 5.4e-91 PFAM
MIR 404 460 4.05e-9 SMART
MIR 473 529 5.52e-11 SMART
MIR 534 591 1.21e-7 SMART
Pfam:PMT_4TMC 608 818 5.9e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222147
Predicted Effect probably damaging
Transcript: ENSMUST00000222634
AA Change: N347T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.378 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: This gene encodes an integral membrane protein that belongs to the dolichyl-phosphate-mannose-protein mannosyltransferase family. The encoded enzyme is found in the membrane of the endoplasmic reticulum. This protein is a component of the protein O-mannosyltransferase enzyme complex which is involved in modification of the protein alpha-dystroglycan. Mutations in the human gene are a cause of different forms of muscular dystrophy-dystroglycanopathy (MDDG), type A2 (also known as Walker-Warburg syndrome), type B2 and type C2 (also known as limb-girdle muscular dystrophy). [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for one knock-out allele die between E8.5 and E9.5 with abnormal Reichert's membrane and runting. Mice homozygous for another allele die before implantation and arrest at the morula stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 A T 5: 30,894,358 R633* probably null Het
Ahnak T C 19: 9,015,248 V4632A probably damaging Het
Asap1 T A 15: 64,094,265 D997V probably damaging Het
Atad2 T C 15: 58,126,594 Y162C probably damaging Het
Atp2b2 G T 6: 113,759,309 S936R probably damaging Het
Bcl11a T A 11: 24,163,650 L331Q probably damaging Het
C6 T A 15: 4,763,486 F358I probably damaging Het
Capn15 C T 17: 25,964,547 S386N probably benign Het
Ccdc66 G A 14: 27,500,447 T113I possibly damaging Het
Cd200 G T 16: 45,397,258 H23Q possibly damaging Het
Cdh17 A G 4: 11,814,945 probably null Het
Ces2b C T 8: 104,833,936 P128S probably damaging Het
Ces3b A T 8: 105,092,638 Q442L probably damaging Het
Chil4 T C 3: 106,202,578 H373R probably benign Het
Ciapin1 C A 8: 94,825,183 probably benign Het
Cnot10 A C 9: 114,625,917 probably null Het
Cpq A G 15: 33,249,997 K167E probably damaging Het
Dennd4b T A 3: 90,277,450 D1118E probably damaging Het
Dnah8 T A 17: 30,875,004 C4691S probably damaging Het
Dnajc1 A G 2: 18,307,087 probably benign Het
Dnhd1 G A 7: 105,655,774 R341H probably damaging Het
Dock10 G T 1: 80,505,170 T2145K probably benign Het
Eif3b T C 5: 140,442,131 V736A probably benign Het
Eno1 G T 4: 150,245,253 V195L probably benign Het
Ewsr1 C T 11: 5,082,263 probably benign Het
Fbn2 T C 18: 58,076,696 T1038A probably benign Het
Gabrb1 T C 5: 72,136,484 I367T possibly damaging Het
Gigyf1 C T 5: 137,524,255 probably benign Het
Glp2r T A 11: 67,764,799 Y39F probably damaging Het
Gm10036 T A 18: 15,833,186 Y131* probably null Het
Gm38706 T C 6: 130,484,998 noncoding transcript Het
Gna15 G A 10: 81,509,384 R216C probably damaging Het
Grin3a A G 4: 49,792,717 F339L probably damaging Het
Grk3 T G 5: 112,966,976 K126T possibly damaging Het
Hspa1l T C 17: 34,977,240 V85A probably benign Het
Iqsec1 A T 6: 90,689,880 L525* probably null Het
Irx3 T C 8: 91,799,676 T467A probably benign Het
Itga2 G A 13: 114,868,206 T530I probably benign Het
Lonp2 T C 8: 86,631,490 V113A probably benign Het
Msx3 C T 7: 140,048,953 R16H possibly damaging Het
Nek3 C A 8: 22,131,297 Q405H probably damaging Het
Nek3 T A 8: 22,131,298 Q403L probably damaging Het
Olfr11 T C 13: 21,638,876 T216A probably benign Het
Olfr798 A G 10: 129,625,888 Y58H probably damaging Het
P4ha1 A G 10: 59,354,362 N367S probably benign Het
Padi6 C A 4: 140,732,258 G429C probably damaging Het
Pidd1 T C 7: 141,441,392 probably benign Het
Plekhg5 T C 4: 152,113,935 V847A probably benign Het
Polr3e A G 7: 120,927,967 D56G probably damaging Het
Ppp1r9a T C 6: 5,134,363 probably benign Het
Rbm33 A T 5: 28,339,298 D184V probably damaging Het
Rims2 A T 15: 39,681,045 T1431S probably damaging Het
Saal1 T C 7: 46,701,928 D208G probably damaging Het
Sis T C 3: 72,928,174 I952V probably benign Het
Slc30a1 T A 1: 191,908,885 D214E probably benign Het
Slc30a8 T C 15: 52,333,647 V318A possibly damaging Het
Smarca2 A G 19: 26,676,724 T770A probably damaging Het
Sptbn4 T A 7: 27,366,428 H2031L probably damaging Het
Ssbp1 A G 6: 40,480,870 S141G probably benign Het
Tgm4 A G 9: 123,061,743 E45G probably damaging Het
Thra T A 11: 98,762,951 S203T probably benign Het
Tle2 T C 10: 81,590,315 Y763H probably damaging Het
Tmem141 T A 2: 25,621,075 I102L probably benign Het
Tmem63c C T 12: 87,057,636 T77I probably benign Het
Tspo2 C A 17: 48,449,019 probably null Het
Ttc19 T A 11: 62,281,514 M1K probably null Het
Ucp1 A G 8: 83,297,891 N282D possibly damaging Het
Vmn1r33 A T 6: 66,612,214 F119I probably benign Het
Vmn2r24 A T 6: 123,815,540 M609L probably benign Het
Vwc2l A T 1: 70,750,983 H146L probably damaging Het
Other mutations in Pomt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Pomt2 APN 12 87124856 missense probably damaging 1.00
IGL00508:Pomt2 APN 12 87119627 missense probably damaging 1.00
IGL01069:Pomt2 APN 12 87110304 missense probably damaging 1.00
IGL01688:Pomt2 APN 12 87147520 missense probably benign
IGL01887:Pomt2 APN 12 87119589 missense probably damaging 1.00
IGL02120:Pomt2 APN 12 87111552 missense probably benign 0.07
IGL02233:Pomt2 APN 12 87111411 missense probably benign 0.00
IGL02305:Pomt2 APN 12 87117929 splice site probably benign
IGL02372:Pomt2 APN 12 87122835 splice site probably benign
IGL02516:Pomt2 APN 12 87119646 missense probably benign 0.00
IGL02616:Pomt2 APN 12 87124862 missense probably damaging 1.00
IGL03039:Pomt2 APN 12 87110366 missense probably benign 0.03
IGL03385:Pomt2 APN 12 87116556 missense probably damaging 1.00
PIT4366001:Pomt2 UTSW 12 87116529 critical splice donor site probably null
R1055:Pomt2 UTSW 12 87147480 missense possibly damaging 0.49
R1716:Pomt2 UTSW 12 87124836 missense probably benign 0.03
R1880:Pomt2 UTSW 12 87135596 missense probably damaging 1.00
R1881:Pomt2 UTSW 12 87135596 missense probably damaging 1.00
R2011:Pomt2 UTSW 12 87111399 missense possibly damaging 0.95
R2443:Pomt2 UTSW 12 87133380 missense probably damaging 1.00
R2913:Pomt2 UTSW 12 87128969 missense probably damaging 0.98
R4036:Pomt2 UTSW 12 87111522 critical splice donor site probably null
R4482:Pomt2 UTSW 12 87131830 missense probably benign 0.41
R4647:Pomt2 UTSW 12 87118083 missense possibly damaging 0.49
R4758:Pomt2 UTSW 12 87122878 missense probably damaging 1.00
R4872:Pomt2 UTSW 12 87110107 missense possibly damaging 0.89
R5071:Pomt2 UTSW 12 87133460 missense probably damaging 0.96
R5074:Pomt2 UTSW 12 87133460 missense probably damaging 0.96
R5132:Pomt2 UTSW 12 87110347 missense probably damaging 0.98
R5514:Pomt2 UTSW 12 87129023 missense probably damaging 1.00
R6128:Pomt2 UTSW 12 87111335 critical splice donor site probably null
R6370:Pomt2 UTSW 12 87109199 missense probably damaging 1.00
R6631:Pomt2 UTSW 12 87139643 critical splice donor site probably null
R6979:Pomt2 UTSW 12 87130351 missense probably damaging 1.00
R7057:Pomt2 UTSW 12 87127378 missense probably damaging 0.96
R7114:Pomt2 UTSW 12 87110376 missense probably damaging 1.00
X0026:Pomt2 UTSW 12 87111375 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCAGTCAATAGAAAATGGGTGAACC -3'
(R):5'- GGAGCTTCCTCTTGAGTTGC -3'

Sequencing Primer
(F):5'- GTGAACCACAGATGACAAGC -3'
(R):5'- TGCTCCCATTGCAGTGAGAAG -3'
Posted On2016-12-15