Incidental Mutation 'R0546:Dennd5a'
ID44830
Institutional Source Beutler Lab
Gene Symbol Dennd5a
Ensembl Gene ENSMUSG00000035901
Gene NameDENN/MADD domain containing 5A
Synonyms1500012B19Rik, Rab6ip1, ORF37
MMRRC Submission 038738-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R0546 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location109893780-109960470 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109921426 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 408 (V408A)
Ref Sequence ENSEMBL: ENSMUSP00000079295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080437] [ENSMUST00000106722]
PDB Structure
Strucure of RAB6(GTP)-R6IP1 complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000080437
AA Change: V408A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000079295
Gene: ENSMUSG00000035901
AA Change: V408A

DomainStartEndE-ValueType
uDENN 12 138 7.71e-45 SMART
DENN 202 390 9.28e-80 SMART
dDENN 512 588 4.06e-21 SMART
low complexity region 832 844 N/A INTRINSIC
RUN 884 947 4.9e-22 SMART
Pfam:PLAT 956 1062 1e-15 PFAM
RUN 1218 1278 3.69e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106722
AA Change: V384A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102333
Gene: ENSMUSG00000035901
AA Change: V384A

DomainStartEndE-ValueType
uDENN 12 114 2.32e-39 SMART
DENN 178 366 9.28e-80 SMART
dDENN 488 564 4.06e-21 SMART
low complexity region 808 820 N/A INTRINSIC
RUN 860 923 4.9e-22 SMART
Pfam:PLAT 932 1038 2.8e-18 PFAM
RUN 1194 1254 3.69e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154002
Meta Mutation Damage Score 0.104 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DENN-domain-containing protein that functions as a RAB-activating guanine nucleotide exchange factor (GEF). This protein catalyzes the conversion of GDP to GTP and thereby converts inactive GDP-bound Rab proteins into their active GTP-bound form. The encoded protein is recruited by RAB6 onto Golgi membranes and is therefore referred to as RAB6-interacting protein 1. This protein binds with RAB39 as well. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene are associated with early infantile epileptic encephalopathy-49. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A G 6: 23,077,077 probably null Het
Actn1 C T 12: 80,178,434 R418Q probably benign Het
Adam39 G A 8: 40,826,431 V620M probably damaging Het
Agr3 C A 12: 35,928,330 T14K probably benign Het
Alpk2 T C 18: 65,306,717 D1002G probably benign Het
Amz2 T A 11: 109,433,954 N221K probably benign Het
Aox4 A G 1: 58,250,174 E752G probably damaging Het
Ap2a1 C T 7: 44,904,708 G500S probably damaging Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Ccdc112 A G 18: 46,291,072 S200P possibly damaging Het
Ccdc18 A T 5: 108,174,964 E643D probably benign Het
Ccdc180 A T 4: 45,904,597 T398S possibly damaging Het
Cnp A G 11: 100,580,723 Y397C probably damaging Het
Cpa4 T C 6: 30,580,963 W184R probably damaging Het
Crebbp A T 16: 4,085,807 I1856N probably damaging Het
Ctrl A G 8: 105,932,334 I200T probably damaging Het
Cyfip1 C T 7: 55,922,816 R934* probably null Het
Dhfr G A 13: 92,368,184 probably null Het
Dnajc6 A T 4: 101,635,191 N740Y probably damaging Het
Fam110a T C 2: 151,970,812 T13A probably benign Het
Fars2 G T 13: 36,204,586 K19N probably benign Het
Fer1l6 A T 15: 58,558,408 probably null Het
Gabra1 T A 11: 42,162,601 T69S probably damaging Het
Galnt18 T G 7: 111,508,141 N475T probably damaging Het
Gbp4 T C 5: 105,120,970 Y439C probably damaging Het
Gpatch2l A G 12: 86,288,848 *409W probably null Het
Hip1r T C 5: 123,999,051 V658A possibly damaging Het
Hspg2 A G 4: 137,502,294 D73G probably benign Het
Ifitm2 A G 7: 140,955,743 V58A possibly damaging Het
Ift172 T C 5: 31,257,601 D1359G probably benign Het
Ing1 A G 8: 11,557,031 D41G probably damaging Het
Itgal C T 7: 127,310,314 T446I probably benign Het
Itgav G T 2: 83,803,242 M978I probably benign Het
Jazf1 A G 6: 52,777,696 Y132H possibly damaging Het
Lgr4 T A 2: 109,999,421 N211K probably damaging Het
Mgat4d A G 8: 83,355,721 N100S possibly damaging Het
Mrgprb3 T C 7: 48,643,515 Y96C probably damaging Het
Myh11 A C 16: 14,205,628 L1562R probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myo15 A G 11: 60,506,313 Y2667C probably damaging Het
Olfr1084 T A 2: 86,639,229 T160S possibly damaging Het
Olfr1085 C T 2: 86,657,891 C189Y possibly damaging Het
Olfr1158 T A 2: 87,990,472 Y120* probably null Het
Olfr128 T A 17: 37,924,338 C257* probably null Het
Olfr608 A G 7: 103,470,700 I220M possibly damaging Het
Olfr814 G A 10: 129,874,538 T73I possibly damaging Het
Paox G T 7: 140,131,678 G148W probably damaging Het
Pkd1 T C 17: 24,580,138 V2777A probably benign Het
Plod2 T A 9: 92,595,335 V360E probably damaging Het
Prune2 T C 19: 17,020,666 probably benign Het
Sbds G T 5: 130,254,078 A3D possibly damaging Het
Sec23a T C 12: 58,985,167 T426A probably benign Het
Sec31a T C 5: 100,404,070 Y148C probably damaging Het
Shprh T A 10: 11,183,887 probably benign Het
Slc16a7 A G 10: 125,230,873 V299A probably benign Het
Smg8 T C 11: 87,083,613 Y174C possibly damaging Het
Snx22 T A 9: 66,068,777 Y58F probably damaging Het
Snx25 A G 8: 46,103,630 Y308H probably benign Het
St3gal2 A G 8: 110,970,106 probably null Het
Stab1 C T 14: 31,139,550 R2500H possibly damaging Het
Steap4 T C 5: 7,975,870 S144P probably damaging Het
Stfa3 T A 16: 36,452,257 probably benign Het
Tmprss9 C A 10: 80,899,323 Q1095K probably benign Het
Top2a A G 11: 98,999,226 V1217A possibly damaging Het
Trhr2 A G 8: 122,358,489 probably null Het
Trim7 A G 11: 48,845,509 E23G probably damaging Het
Trpv3 A T 11: 73,297,187 E788V probably damaging Het
Ttn A G 2: 76,745,519 I25010T probably damaging Het
Ube2ql1 T C 13: 69,739,300 H14R unknown Het
Uggt1 C T 1: 36,195,971 R419H probably benign Het
Xpo4 A G 14: 57,613,274 V391A probably benign Het
Zfhx3 A G 8: 108,794,187 D647G probably damaging Het
Zfp354c A T 11: 50,815,630 M206K probably benign Het
Zfp804a A G 2: 82,258,920 N1031S possibly damaging Het
Zfp868 A G 8: 69,612,231 V151A probably benign Het
Other mutations in Dennd5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Dennd5a APN 7 109908372 missense probably benign
IGL01338:Dennd5a APN 7 109919404 missense possibly damaging 0.92
IGL01618:Dennd5a APN 7 109934095 missense probably damaging 1.00
IGL02047:Dennd5a APN 7 109934784 missense possibly damaging 0.92
IGL02277:Dennd5a APN 7 109897969 missense possibly damaging 0.61
IGL02492:Dennd5a APN 7 109933637 missense probably benign
IGL02697:Dennd5a APN 7 109894781 missense probably damaging 1.00
IGL02935:Dennd5a APN 7 109921307 missense possibly damaging 0.80
IGL02986:Dennd5a APN 7 109935524 missense probably benign
IGL03088:Dennd5a APN 7 109908381 missense probably damaging 1.00
IGL03156:Dennd5a APN 7 109919255 splice site probably benign
IGL03181:Dennd5a APN 7 109933658 missense probably damaging 1.00
big_pal UTSW 7 109919423 nonsense probably null
Celestial UTSW 7 109901089 missense probably damaging 1.00
PIT4434001:Dennd5a UTSW 7 109933624 missense probably damaging 1.00
R0055:Dennd5a UTSW 7 109899791 missense possibly damaging 0.72
R0055:Dennd5a UTSW 7 109899791 missense possibly damaging 0.72
R0092:Dennd5a UTSW 7 109899806 missense possibly damaging 0.95
R0111:Dennd5a UTSW 7 109934754 missense probably damaging 1.00
R0517:Dennd5a UTSW 7 109934761 missense probably damaging 1.00
R0811:Dennd5a UTSW 7 109933613 missense possibly damaging 0.93
R0812:Dennd5a UTSW 7 109933613 missense possibly damaging 0.93
R0827:Dennd5a UTSW 7 109899731 missense probably damaging 1.00
R0831:Dennd5a UTSW 7 109934754 missense probably damaging 1.00
R1075:Dennd5a UTSW 7 109918601 missense probably benign
R1115:Dennd5a UTSW 7 109918761 missense probably damaging 1.00
R1128:Dennd5a UTSW 7 109921334 nonsense probably null
R1300:Dennd5a UTSW 7 109919407 missense probably benign
R1698:Dennd5a UTSW 7 109917380 splice site probably null
R1711:Dennd5a UTSW 7 109918712 missense probably benign 0.00
R1771:Dennd5a UTSW 7 109918686 missense probably damaging 0.98
R1803:Dennd5a UTSW 7 109898613 missense probably benign 0.00
R2064:Dennd5a UTSW 7 109898693 splice site probably benign
R2176:Dennd5a UTSW 7 109905120 intron probably null
R2182:Dennd5a UTSW 7 109933994 missense probably benign 0.03
R2852:Dennd5a UTSW 7 109933671 missense probably damaging 1.00
R2853:Dennd5a UTSW 7 109933671 missense probably damaging 1.00
R3035:Dennd5a UTSW 7 109921352 missense probably benign 0.00
R3835:Dennd5a UTSW 7 109934242 missense probably benign 0.00
R3953:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R3954:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R3955:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R3957:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R4014:Dennd5a UTSW 7 109935481 critical splice donor site probably null
R4166:Dennd5a UTSW 7 109926825 critical splice donor site probably null
R4362:Dennd5a UTSW 7 109896343 missense probably damaging 1.00
R4567:Dennd5a UTSW 7 109899735 missense probably benign 0.06
R4700:Dennd5a UTSW 7 109921198 missense probably benign 0.01
R4734:Dennd5a UTSW 7 109896336 missense probably damaging 0.96
R4914:Dennd5a UTSW 7 109901089 missense probably damaging 1.00
R4915:Dennd5a UTSW 7 109901089 missense probably damaging 1.00
R4918:Dennd5a UTSW 7 109901089 missense probably damaging 1.00
R4992:Dennd5a UTSW 7 109894712 missense probably damaging 0.98
R5011:Dennd5a UTSW 7 109914776 missense possibly damaging 0.89
R5013:Dennd5a UTSW 7 109914776 missense possibly damaging 0.89
R5034:Dennd5a UTSW 7 109899797 missense probably damaging 0.98
R5194:Dennd5a UTSW 7 109933729 missense probably damaging 1.00
R5359:Dennd5a UTSW 7 109897962 missense probably damaging 1.00
R5430:Dennd5a UTSW 7 109934240 missense probably damaging 1.00
R5586:Dennd5a UTSW 7 109905721 missense possibly damaging 0.72
R5607:Dennd5a UTSW 7 109919423 nonsense probably null
R5608:Dennd5a UTSW 7 109919423 nonsense probably null
R5783:Dennd5a UTSW 7 109894636 missense probably damaging 0.97
R5866:Dennd5a UTSW 7 109919360 missense probably benign 0.00
R5890:Dennd5a UTSW 7 109934221 missense probably benign 0.00
R6053:Dennd5a UTSW 7 109933745 missense probably damaging 1.00
R6247:Dennd5a UTSW 7 109898682 missense probably damaging 1.00
R6362:Dennd5a UTSW 7 109934265 nonsense probably null
R6446:Dennd5a UTSW 7 109894666 missense probably damaging 1.00
R6894:Dennd5a UTSW 7 109901118 missense probably damaging 1.00
R7061:Dennd5a UTSW 7 109905179 missense probably benign 0.19
R7115:Dennd5a UTSW 7 109894754 missense probably damaging 1.00
R7133:Dennd5a UTSW 7 109896242 critical splice donor site probably null
R7302:Dennd5a UTSW 7 109905699 missense probably damaging 0.98
Z1088:Dennd5a UTSW 7 109894747 missense possibly damaging 0.73
Z1088:Dennd5a UTSW 7 109905273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCTTGACCAAAGCTTGCAACC -3'
(R):5'- AGACTTTGACACTTCTCACGAACCG -3'

Sequencing Primer
(F):5'- CTTGCAACCGAGCAATAGTTTC -3'
(R):5'- CGAACCGGAATCCATTGATTTG -3'
Posted On2013-06-11