Incidental Mutation 'R5801:Slco6b1'
ID448318
Institutional Source Beutler Lab
Gene Symbol Slco6b1
Ensembl Gene ENSMUSG00000045463
Gene Namesolute carrier organic anion transporter family, member 6b1
Synonyms1700022M03Rik
MMRRC Submission 043390-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5801 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location96906176-96997577 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) C to T at 96947631 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178359
SMART Domains Protein: ENSMUSP00000136663
Gene: ENSMUSG00000045463

DomainStartEndE-ValueType
Pfam:MFS_1 103 481 1.6e-12 PFAM
Pfam:OATP 108 668 9.7e-128 PFAM
Pfam:Kazal_2 511 552 5.1e-8 PFAM
transmembrane domain 670 692 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 C T 3: 89,342,361 V667I probably damaging Het
Adamts14 T C 10: 61,202,996 S912G probably damaging Het
Adamts20 C A 15: 94,347,670 E584* probably null Het
Ago3 A T 4: 126,371,768 N284K possibly damaging Het
Alx3 T A 3: 107,604,941 Y298* probably null Het
Arhgap32 A G 9: 32,255,788 I574V probably benign Het
Bsn C T 9: 108,113,009 R1848Q possibly damaging Het
Caskin2 T C 11: 115,803,473 D400G probably damaging Het
Cdc73 T A 1: 143,608,543 H525L probably benign Het
Cep135 A G 5: 76,630,676 E674G probably damaging Het
Cic G A 7: 25,271,438 R198Q possibly damaging Het
Col5a2 T C 1: 45,389,481 probably null Het
Col6a5 A G 9: 105,948,367 V9A unknown Het
Cpsf7 A T 19: 10,539,632 D366V probably benign Het
Cuedc2 T C 19: 46,331,357 E173G probably damaging Het
D5Ertd579e T C 5: 36,604,569 E1318G probably damaging Het
Ddx55 T C 5: 124,566,497 probably null Het
Dennd1b T A 1: 139,039,989 probably null Het
Dpy19l3 T C 7: 35,725,298 T111A probably benign Het
Edn1 C A 13: 42,306,806 A179E probably benign Het
Eif2b1 T C 5: 124,574,712 probably null Het
Epha5 A G 5: 84,331,226 probably null Het
Erc1 T A 6: 119,773,822 N466I probably damaging Het
Ermp1 A G 19: 29,612,828 F825L probably damaging Het
Fbxo18 T C 2: 11,769,826 D36G probably damaging Het
Fbxo41 G T 6: 85,484,533 F64L probably damaging Het
Gabrb2 T C 11: 42,421,389 S14P probably benign Het
Gm13178 T A 4: 144,703,636 D261V probably damaging Het
Gm6505 A T 3: 28,764,967 noncoding transcript Het
Ighv1-18 T A 12: 114,682,708 D91V probably damaging Het
Imp3 A G 9: 56,937,802 D99G probably benign Het
Iqub T C 6: 24,449,769 K699R probably benign Het
Itpk1 A G 12: 102,573,945 V293A probably damaging Het
Lrrc49 A T 9: 60,602,633 F157L probably damaging Het
Mapk1ip1 T A 7: 138,836,510 T64S possibly damaging Het
Mrpl9 T C 3: 94,447,796 L225P possibly damaging Het
Ms4a14 A G 19: 11,301,786 L1136S possibly damaging Het
Ms4a14 A T 19: 11,301,882 I1104K possibly damaging Het
Nkain2 T C 10: 32,402,268 T54A probably damaging Het
Ociad2 A G 5: 73,326,299 F60S probably damaging Het
Olfr397 T C 11: 73,964,946 F113L probably benign Het
Polk T A 13: 96,483,586 H723L probably damaging Het
Prickle4 C A 17: 47,688,773 R285L possibly damaging Het
Psmd2 A G 16: 20,654,922 N121S probably damaging Het
Rab11fip5 T A 6: 85,337,600 S1212C probably damaging Het
Rasgef1c T G 11: 49,970,056 M266R probably damaging Het
Rpusd4 A G 9: 35,270,073 E155G possibly damaging Het
Rrbp1 A G 2: 143,989,783 S155P probably damaging Het
Safb2 T C 17: 56,563,103 Y991C possibly damaging Het
Shank1 G A 7: 44,356,816 E1986K possibly damaging Het
Slc22a14 A G 9: 119,172,083 F482L probably benign Het
Slc35e3 T A 10: 117,745,862 M109L probably benign Het
Slco4c1 T C 1: 96,872,084 N9S probably damaging Het
Sptan1 A G 2: 30,030,601 probably null Het
Sptlc2 T C 12: 87,341,771 probably null Het
Stk10 C T 11: 32,596,748 P335L probably benign Het
Strip1 A C 3: 107,621,441 L391R possibly damaging Het
Tacr1 T A 6: 82,557,153 S387T probably benign Het
Thbs2 A T 17: 14,687,863 F213I probably damaging Het
Thbs3 A T 3: 89,224,397 Y692F probably benign Het
Tktl2 C A 8: 66,513,647 A619E probably benign Het
Tmc3 A T 7: 83,622,478 E946V possibly damaging Het
Tmem132d A G 5: 127,784,900 V719A possibly damaging Het
Trpa1 T C 1: 14,898,078 H488R probably damaging Het
Tsfm TCACTCC TCACTCCACTCC 10: 127,022,837 probably null Het
Wdr35 A G 12: 9,006,723 T503A possibly damaging Het
Zfp109 T C 7: 24,228,701 K436E probably damaging Het
Zfp423 A G 8: 87,859,362 Y78H probably damaging Het
Zfp970 A G 2: 177,473,358 K26E probably damaging Het
Other mutations in Slco6b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Slco6b1 APN 1 96988650 exon noncoding transcript
IGL02110:Slco6b1 APN 1 96987882 exon noncoding transcript
IGL02416:Slco6b1 APN 1 96924333 exon noncoding transcript
IGL03406:Slco6b1 APN 1 96947585 exon noncoding transcript
R0147:Slco6b1 UTSW 1 96987837 exon noncoding transcript
R0277:Slco6b1 UTSW 1 96988673 exon noncoding transcript
R0513:Slco6b1 UTSW 1 96997184 unclassified noncoding transcript
R1401:Slco6b1 UTSW 1 96929885 splice site noncoding transcript
R1823:Slco6b1 UTSW 1 96961176 exon noncoding transcript
R1888:Slco6b1 UTSW 1 96922061 splice site noncoding transcript
R4125:Slco6b1 UTSW 1 96987897 exon noncoding transcript
R4281:Slco6b1 UTSW 1 96997390 unclassified noncoding transcript
R4282:Slco6b1 UTSW 1 96997390 unclassified noncoding transcript
R4576:Slco6b1 UTSW 1 96988697 exon noncoding transcript
R4850:Slco6b1 UTSW 1 96911833 unclassified noncoding transcript
R5222:Slco6b1 UTSW 1 96997491 unclassified noncoding transcript
R5389:Slco6b1 UTSW 1 96988584 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- ACGAGTCTGGAAAATATGCCTTC -3'
(R):5'- GCTTCATCCACTTGCACAAGAC -3'

Sequencing Primer
(F):5'- GCAGTGATTCCAGCAAAT -3'
(R):5'- TCCACTTGCACAAGACTGTATG -3'
Posted On2016-12-15