Incidental Mutation 'R5801:Erc1'
ID448345
Institutional Source Beutler Lab
Gene Symbol Erc1
Ensembl Gene ENSMUSG00000030172
Gene NameELKS/RAB6-interacting/CAST family member 1
SynonymsB430107L16Rik, Rab6ip2, 5033405M01Rik, RAB6IP2A, 9630025C19Rik, RAB6IP2B
MMRRC Submission 043390-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5801 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location119570796-119848167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119773822 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 466 (N466I)
Ref Sequence ENSEMBL: ENSMUSP00000138823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032279] [ENSMUST00000079582] [ENSMUST00000183703] [ENSMUST00000183880] [ENSMUST00000183911] [ENSMUST00000184838] [ENSMUST00000184864] [ENSMUST00000185139] [ENSMUST00000185143]
Predicted Effect probably damaging
Transcript: ENSMUST00000032279
AA Change: N494I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032279
Gene: ENSMUSG00000030172
AA Change: N494I

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 466 1.8e-142 PFAM
Pfam:Cast 453 838 3.5e-163 PFAM
Pfam:Cast 833 986 8e-61 PFAM
Pfam:RBD-FIP 1072 1112 1.5e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079582
AA Change: N315I

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078534
Gene: ENSMUSG00000030172
AA Change: N315I

DomainStartEndE-ValueType
Pfam:Cast 3 349 8.9e-149 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183703
AA Change: N494I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139031
Gene: ENSMUSG00000030172
AA Change: N494I

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 986 6.9e-291 PFAM
Pfam:RBD-FIP 1072 1112 1.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183872
Predicted Effect probably damaging
Transcript: ENSMUST00000183880
AA Change: N466I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138823
Gene: ENSMUSG00000030172
AA Change: N466I

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 914 4.3e-296 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183911
AA Change: N466I

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139118
Gene: ENSMUSG00000030172
AA Change: N466I

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 954 4.2e-293 PFAM
Pfam:RBD-FIP 1040 1080 8.5e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000184838
AA Change: N494I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139030
Gene: ENSMUSG00000030172
AA Change: N494I

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 942 3.5e-291 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000184864
AA Change: N494I

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139256
Gene: ENSMUSG00000030172
AA Change: N494I

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 982 2e-288 PFAM
Pfam:RBD-FIP 1068 1108 8.7e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185139
AA Change: N466I

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139152
Gene: ENSMUSG00000030172
AA Change: N466I

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 958 3.6e-295 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185143
SMART Domains Protein: ENSMUSP00000138989
Gene: ENSMUSG00000030172

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 224 1.7e-28 PFAM
Pfam:Cast 222 686 8e-145 PFAM
Meta Mutation Damage Score 0.238 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of RIM-binding proteins. RIMs are active zone proteins that regulate neurotransmitter release. This gene has been found fused to the receptor-type tyrosine kinase gene RET by gene rearrangement due to the translocation t(10;12)(q11;p13) in thyroid papillary carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for null mutations in this gene display embryonic lethality. Mice heterozygous for a gene trap null allele exhibit increased sensitivity to ionizing radiation-induced lethality, with males being more affected than females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 C T 3: 89,342,361 V667I probably damaging Het
Adamts14 T C 10: 61,202,996 S912G probably damaging Het
Adamts20 C A 15: 94,347,670 E584* probably null Het
Ago3 A T 4: 126,371,768 N284K possibly damaging Het
Alx3 T A 3: 107,604,941 Y298* probably null Het
Arhgap32 A G 9: 32,255,788 I574V probably benign Het
Bsn C T 9: 108,113,009 R1848Q possibly damaging Het
Caskin2 T C 11: 115,803,473 D400G probably damaging Het
Cdc73 T A 1: 143,608,543 H525L probably benign Het
Cep135 A G 5: 76,630,676 E674G probably damaging Het
Cic G A 7: 25,271,438 R198Q possibly damaging Het
Col5a2 T C 1: 45,389,481 probably null Het
Col6a5 A G 9: 105,948,367 V9A unknown Het
Cpsf7 A T 19: 10,539,632 D366V probably benign Het
Cuedc2 T C 19: 46,331,357 E173G probably damaging Het
D5Ertd579e T C 5: 36,604,569 E1318G probably damaging Het
Ddx55 T C 5: 124,566,497 probably null Het
Dennd1b T A 1: 139,039,989 probably null Het
Dpy19l3 T C 7: 35,725,298 T111A probably benign Het
Edn1 C A 13: 42,306,806 A179E probably benign Het
Eif2b1 T C 5: 124,574,712 probably null Het
Epha5 A G 5: 84,331,226 probably null Het
Ermp1 A G 19: 29,612,828 F825L probably damaging Het
Fbxo18 T C 2: 11,769,826 D36G probably damaging Het
Fbxo41 G T 6: 85,484,533 F64L probably damaging Het
Gabrb2 T C 11: 42,421,389 S14P probably benign Het
Gm13178 T A 4: 144,703,636 D261V probably damaging Het
Gm6505 A T 3: 28,764,967 noncoding transcript Het
Ighv1-18 T A 12: 114,682,708 D91V probably damaging Het
Imp3 A G 9: 56,937,802 D99G probably benign Het
Iqub T C 6: 24,449,769 K699R probably benign Het
Itpk1 A G 12: 102,573,945 V293A probably damaging Het
Lrrc49 A T 9: 60,602,633 F157L probably damaging Het
Mapk1ip1 T A 7: 138,836,510 T64S possibly damaging Het
Mrpl9 T C 3: 94,447,796 L225P possibly damaging Het
Ms4a14 A G 19: 11,301,786 L1136S possibly damaging Het
Ms4a14 A T 19: 11,301,882 I1104K possibly damaging Het
Nkain2 T C 10: 32,402,268 T54A probably damaging Het
Ociad2 A G 5: 73,326,299 F60S probably damaging Het
Olfr397 T C 11: 73,964,946 F113L probably benign Het
Polk T A 13: 96,483,586 H723L probably damaging Het
Prickle4 C A 17: 47,688,773 R285L possibly damaging Het
Psmd2 A G 16: 20,654,922 N121S probably damaging Het
Rab11fip5 T A 6: 85,337,600 S1212C probably damaging Het
Rasgef1c T G 11: 49,970,056 M266R probably damaging Het
Rpusd4 A G 9: 35,270,073 E155G possibly damaging Het
Rrbp1 A G 2: 143,989,783 S155P probably damaging Het
Safb2 T C 17: 56,563,103 Y991C possibly damaging Het
Shank1 G A 7: 44,356,816 E1986K possibly damaging Het
Slc22a14 A G 9: 119,172,083 F482L probably benign Het
Slc35e3 T A 10: 117,745,862 M109L probably benign Het
Slco4c1 T C 1: 96,872,084 N9S probably damaging Het
Slco6b1 C T 1: 96,947,631 noncoding transcript Het
Sptan1 A G 2: 30,030,601 probably null Het
Sptlc2 T C 12: 87,341,771 probably null Het
Stk10 C T 11: 32,596,748 P335L probably benign Het
Strip1 A C 3: 107,621,441 L391R possibly damaging Het
Tacr1 T A 6: 82,557,153 S387T probably benign Het
Thbs2 A T 17: 14,687,863 F213I probably damaging Het
Thbs3 A T 3: 89,224,397 Y692F probably benign Het
Tktl2 C A 8: 66,513,647 A619E probably benign Het
Tmc3 A T 7: 83,622,478 E946V possibly damaging Het
Tmem132d A G 5: 127,784,900 V719A possibly damaging Het
Trpa1 T C 1: 14,898,078 H488R probably damaging Het
Tsfm TCACTCC TCACTCCACTCC 10: 127,022,837 probably null Het
Wdr35 A G 12: 9,006,723 T503A possibly damaging Het
Zfp109 T C 7: 24,228,701 K436E probably damaging Het
Zfp423 A G 8: 87,859,362 Y78H probably damaging Het
Zfp970 A G 2: 177,473,358 K26E probably damaging Het
Other mutations in Erc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Erc1 APN 6 119722303 missense probably damaging 0.96
IGL01345:Erc1 APN 6 119761263 nonsense probably null
IGL01370:Erc1 APN 6 119824465 missense probably damaging 1.00
IGL01443:Erc1 APN 6 119824471 missense probably damaging 1.00
IGL01550:Erc1 APN 6 119783394 missense probably damaging 0.96
IGL01798:Erc1 APN 6 119620337 missense possibly damaging 0.86
IGL02032:Erc1 APN 6 119630609 missense probably damaging 1.00
IGL02239:Erc1 APN 6 119773891 missense probably damaging 0.96
IGL02341:Erc1 APN 6 119594973 missense possibly damaging 0.92
PIT4498001:Erc1 UTSW 6 119779491 missense possibly damaging 0.92
R0149:Erc1 UTSW 6 119824830 missense probably damaging 1.00
R0277:Erc1 UTSW 6 119620328 missense probably damaging 1.00
R0323:Erc1 UTSW 6 119620328 missense probably damaging 1.00
R1053:Erc1 UTSW 6 119796926 missense probably damaging 1.00
R1252:Erc1 UTSW 6 119743392 missense possibly damaging 0.84
R1355:Erc1 UTSW 6 119743420 nonsense probably null
R1470:Erc1 UTSW 6 119694602 missense probably damaging 1.00
R1470:Erc1 UTSW 6 119694602 missense probably damaging 1.00
R1680:Erc1 UTSW 6 119575761 missense probably damaging 1.00
R1833:Erc1 UTSW 6 119743429 missense possibly damaging 0.81
R1954:Erc1 UTSW 6 119797305 missense probably damaging 1.00
R2037:Erc1 UTSW 6 119722255 missense possibly damaging 0.94
R2365:Erc1 UTSW 6 119575695 missense probably damaging 1.00
R3751:Erc1 UTSW 6 119824960 missense probably damaging 0.99
R4473:Erc1 UTSW 6 119848456 unclassified probably null
R4778:Erc1 UTSW 6 119797337 splice site probably null
R4897:Erc1 UTSW 6 119777986 critical splice donor site probably null
R5260:Erc1 UTSW 6 119761159 missense probably damaging 1.00
R5382:Erc1 UTSW 6 119761272 missense probably benign 0.02
R5405:Erc1 UTSW 6 119824944 missense probably damaging 1.00
R6341:Erc1 UTSW 6 119777998 missense possibly damaging 0.94
R6588:Erc1 UTSW 6 119575726 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACCATGGATAAAAGTTACTGCTTCC -3'
(R):5'- CGTGCTTTGCCACTAAAGC -3'

Sequencing Primer
(F):5'- CTGCTTCCAAATCTAAATGAATCAGG -3'
(R):5'- GCTTTGCCACTAAAGCCCTCC -3'
Posted On2016-12-15