Incidental Mutation 'R5804:Ager'
ID448428
Institutional Source Beutler Lab
Gene Symbol Ager
Ensembl Gene ENSMUSG00000015452
Gene Nameadvanced glycosylation end product-specific receptor
SynonymsRAGE
MMRRC Submission 043211-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R5804 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34597862-34600936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34598183 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 32 (E32G)
Ref Sequence ENSEMBL: ENSMUSP00000134401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015596] [ENSMUST00000015622] [ENSMUST00000038149] [ENSMUST00000173328] [ENSMUST00000173992] [ENSMUST00000174069] [ENSMUST00000174496] [ENSMUST00000174532] [ENSMUST00000183827]
Predicted Effect probably damaging
Transcript: ENSMUST00000015596
AA Change: E32G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000015596
Gene: ENSMUSG00000015452
AA Change: E32G

DomainStartEndE-ValueType
IG 23 117 2.44e-7 SMART
Pfam:C2-set_2 123 217 4.3e-24 PFAM
IGc2 248 306 7.63e-18 SMART
transmembrane domain 339 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000015622
SMART Domains Protein: ENSMUSP00000015622
Gene: ENSMUSG00000015478

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
RING 27 67 1.5e-8 SMART
transmembrane domain 118 140 N/A INTRINSIC
transmembrane domain 160 179 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038149
SMART Domains Protein: ENSMUSP00000040464
Gene: ENSMUSG00000034673

DomainStartEndE-ValueType
low complexity region 7 49 N/A INTRINSIC
Pfam:PBC 50 243 1.3e-97 PFAM
HOX 244 309 1.9e-18 SMART
low complexity region 327 353 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172932
SMART Domains Protein: ENSMUSP00000133660
Gene: ENSMUSG00000015452

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173229
Predicted Effect probably benign
Transcript: ENSMUST00000173328
SMART Domains Protein: ENSMUSP00000133766
Gene: ENSMUSG00000034673

DomainStartEndE-ValueType
Pfam:PBC 1 161 5e-84 PFAM
HOX 162 227 1.9e-18 SMART
low complexity region 245 271 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173589
SMART Domains Protein: ENSMUSP00000133845
Gene: ENSMUSG00000015452

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173992
AA Change: E32G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134579
Gene: ENSMUSG00000015452
AA Change: E32G

DomainStartEndE-ValueType
IG 23 108 3.23e-7 SMART
Pfam:C2-set_2 114 208 3.3e-24 PFAM
IGc2 239 297 7.63e-18 SMART
transmembrane domain 321 343 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174045
Predicted Effect probably damaging
Transcript: ENSMUST00000174069
AA Change: E32G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133391
Gene: ENSMUSG00000015452
AA Change: E32G

DomainStartEndE-ValueType
IG 23 117 2.44e-7 SMART
Pfam:C2-set_2 123 217 2.5e-24 PFAM
IGc2 248 306 7.63e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174475
Predicted Effect probably damaging
Transcript: ENSMUST00000174496
AA Change: E32G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134401
Gene: ENSMUSG00000015452
AA Change: E32G

DomainStartEndE-ValueType
IG 23 117 2.44e-7 SMART
Pfam:C2-set_2 123 217 3.4e-24 PFAM
IGc2 248 306 7.63e-18 SMART
transmembrane domain 330 352 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174532
SMART Domains Protein: ENSMUSP00000133744
Gene: ENSMUSG00000034673

DomainStartEndE-ValueType
Pfam:PBC 1 148 3.5e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174640
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174756
Predicted Effect probably benign
Transcript: ENSMUST00000183827
SMART Domains Protein: ENSMUSP00000139079
Gene: ENSMUSG00000034673

DomainStartEndE-ValueType
Pfam:PBC 1 183 9.5e-98 PFAM
HOX 184 249 1.9e-18 SMART
low complexity region 267 293 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184805
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184846
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The advanced glycosylation end product (AGE) receptor encoded by this gene is a member of the immunoglobulin superfamily of cell surface receptors. It is a multiligand receptor, and besides AGE, interacts with other molecules implicated in homeostasis, development, and inflammation, and certain diseases, such as diabetes and Alzheimer's disease. Many alternatively spliced transcript variants encoding different isoforms, as well as non-protein-coding variants, have been described for this gene (PMID:18089847). [provided by RefSeq, May 2011]
PHENOTYPE: Homozygotes for a null allele show increased bone mass and strength, reduced osteoclast number, abnormal blood vessel healing, and altered development of nephropathy and pain perception in induced diabetes. Homozygotes for another null allele show restored diabetes-induced angiogenic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A G 11: 101,990,814 N112S probably damaging Het
Abat A T 16: 8,578,236 R19* probably null Het
Abcb9 A G 5: 124,080,055 M406T probably benign Het
Cdk10 T A 8: 123,228,840 probably null Het
Ctsl A T 13: 64,366,488 Y259N probably damaging Het
Ctu2 T C 8: 122,481,226 probably null Het
Dse T A 10: 34,153,379 I572F possibly damaging Het
Flt1 A T 5: 147,580,437 probably null Het
Gatm T A 2: 122,602,602 Y193F probably benign Het
Gpaa1 T C 15: 76,332,626 F170S probably damaging Het
Grm3 A G 5: 9,570,155 L363P probably benign Het
Heatr5b G A 17: 78,831,522 P64S probably damaging Het
Hfm1 A G 5: 106,878,589 probably null Het
Hivep2 A C 10: 14,133,775 K1725N probably benign Het
Hmcn1 A T 1: 150,674,347 C2695* probably null Het
Hmgcr G A 13: 96,666,187 T68M probably damaging Het
Igsf21 A T 4: 140,028,074 D423E possibly damaging Het
Jag1 T C 2: 137,088,204 N751S probably benign Het
Klrc2 A T 6: 129,660,473 N28K possibly damaging Het
Lrrc8c A T 5: 105,579,557 D29V possibly damaging Het
Mtcl1 A C 17: 66,343,137 S1329A probably benign Het
Nin C T 12: 70,045,601 V645I possibly damaging Het
Olfr1006 T A 2: 85,674,338 D271V probably damaging Het
Olfr1262 T C 2: 90,002,988 I194T possibly damaging Het
Olfr283 T A 15: 98,378,334 M259L probably benign Het
Olfr640 T C 7: 104,022,232 I29V probably benign Het
Pfpl A T 19: 12,429,663 H426L probably benign Het
Poteg A G 8: 27,456,798 D238G probably damaging Het
Psen1 T C 12: 83,731,700 F386L probably damaging Het
Rassf9 A T 10: 102,545,044 I96F probably damaging Het
Robo1 T C 16: 73,043,189 probably null Het
Slc16a4 A T 3: 107,298,964 M117L probably benign Het
Slc4a8 A G 15: 100,791,625 N372S possibly damaging Het
Stmn4 G A 14: 66,356,299 G47D probably benign Het
Tex26 A G 5: 149,463,147 N137S possibly damaging Het
Ttn T A 2: 76,916,819 I4629F probably benign Het
Ubash3a G A 17: 31,208,232 probably null Het
Ube2cbp T C 9: 86,425,348 I233V probably benign Het
Utrn T A 10: 12,421,625 T680S probably damaging Het
Vps13d G A 4: 145,100,070 T2846I probably benign Het
Zbtb22 TGGACCCGGGAC TGGACCCGGGACCCGGGAC 17: 33,918,619 probably null Het
Zfp41 C T 15: 75,618,708 P170S probably damaging Het
Other mutations in Ager
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01808:Ager APN 17 34599457 missense probably damaging 0.97
IGL02143:Ager APN 17 34599118 missense probably damaging 1.00
IGL02219:Ager APN 17 34600120 missense probably damaging 0.97
R1337:Ager UTSW 17 34600622 critical splice donor site probably null
R1584:Ager UTSW 17 34600718 missense probably damaging 1.00
R2269:Ager UTSW 17 34599150 missense probably damaging 1.00
R5881:Ager UTSW 17 34600077 missense probably damaging 1.00
R5939:Ager UTSW 17 34598201 missense probably damaging 1.00
R6276:Ager UTSW 17 34598754 missense possibly damaging 0.86
R6551:Ager UTSW 17 34599468 unclassified probably null
Predicted Primers PCR Primer
(F):5'- TTGCTCTATGGGGTGAGACAC -3'
(R):5'- GGACCTTCCAAGCTTCAGTTC -3'

Sequencing Primer
(F):5'- GTGAGACACTCCCAGCCC -3'
(R):5'- CTTCCTGTGTTCTGTGAAGAAGAG -3'
Posted On2016-12-15