Incidental Mutation 'R5805:Mef2a'
ID448446
Institutional Source Beutler Lab
Gene Symbol Mef2a
Ensembl Gene ENSMUSG00000030557
Gene Namemyocyte enhancer factor 2A
SynonymsA430079H05Rik
MMRRC Submission 043212-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5805 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location67231163-67372858 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67251668 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 285 (M285V)
Ref Sequence ENSEMBL: ENSMUSP00000075664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032776] [ENSMUST00000072460] [ENSMUST00000076325] [ENSMUST00000107476] [ENSMUST00000133074] [ENSMUST00000135493] [ENSMUST00000156690] [ENSMUST00000207715] [ENSMUST00000208512]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032776
AA Change: M285V

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032776
Gene: ENSMUSG00000030557
AA Change: M285V

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Pfam:HJURP_C 90 155 5.2e-30 PFAM
low complexity region 161 181 N/A INTRINSIC
low complexity region 255 265 N/A INTRINSIC
low complexity region 301 316 N/A INTRINSIC
low complexity region 412 431 N/A INTRINSIC
low complexity region 438 457 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072460
SMART Domains Protein: ENSMUSP00000138645
Gene: ENSMUSG00000030557

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000076325
AA Change: M285V

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000075664
Gene: ENSMUSG00000030557
AA Change: M285V

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Pfam:HJURP_C 90 155 5.2e-30 PFAM
low complexity region 161 181 N/A INTRINSIC
low complexity region 255 265 N/A INTRINSIC
low complexity region 301 316 N/A INTRINSIC
low complexity region 412 431 N/A INTRINSIC
low complexity region 438 457 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107476
AA Change: M283V

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103100
Gene: ENSMUSG00000030557
AA Change: M283V

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Pfam:HJURP_C 90 153 3.7e-8 PFAM
low complexity region 159 179 N/A INTRINSIC
low complexity region 253 263 N/A INTRINSIC
low complexity region 299 314 N/A INTRINSIC
low complexity region 410 429 N/A INTRINSIC
low complexity region 436 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133074
SMART Domains Protein: ENSMUSP00000116144
Gene: ENSMUSG00000030557

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Pfam:HJURP_C 90 153 8.7e-9 PFAM
low complexity region 159 179 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000135493
AA Change: M283V

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138566
Gene: ENSMUSG00000030557
AA Change: M283V

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Pfam:HJURP_C 90 153 3.7e-8 PFAM
low complexity region 159 179 N/A INTRINSIC
low complexity region 253 263 N/A INTRINSIC
low complexity region 288 294 N/A INTRINSIC
low complexity region 307 322 N/A INTRINSIC
low complexity region 418 437 N/A INTRINSIC
low complexity region 444 463 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000156690
AA Change: M283V

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000117496
Gene: ENSMUSG00000030557
AA Change: M283V

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Pfam:HJURP_C 90 152 1.3e-8 PFAM
low complexity region 159 179 N/A INTRINSIC
low complexity region 253 263 N/A INTRINSIC
low complexity region 288 294 N/A INTRINSIC
low complexity region 307 322 N/A INTRINSIC
low complexity region 418 437 N/A INTRINSIC
low complexity region 444 463 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000207715
AA Change: M119V

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207794
Predicted Effect probably benign
Transcript: ENSMUST00000208512
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA-binding transcription factor that activates many muscle-specific, growth factor-induced, and stress-induced genes. The encoded protein can act as a homodimer or as a heterodimer and is involved in several cellular processes, including muscle development, neuronal differentiation, cell growth control, and apoptosis. Defects in this gene could be a cause of autosomal dominant coronary artery disease 1 with myocardial infarction (ADCAD1). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Inactivation of this gene results in cardiac sudden death. Mice dying in the early postnatal period exhibit ventricular dilation, while mice dying in adulthood show a reduced number of mitochondria in the heart. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 C T 11: 110,279,390 C1293Y probably benign Het
Adam8 T A 7: 139,985,881 D611V probably damaging Het
Arhgap33 T C 7: 30,526,414 T576A probably benign Het
Atf7 A T 15: 102,557,587 probably null Het
Baiap3 T A 17: 25,247,515 T464S probably benign Het
Ccdc40 T C 11: 119,246,080 probably null Het
Celf2 T C 2: 6,553,787 E430G probably damaging Het
Chia1 A G 3: 106,128,476 T211A probably damaging Het
Ciz1 T C 2: 32,367,396 F151S probably damaging Het
Dnm2 A G 9: 21,467,669 T175A probably damaging Het
Doc2b A G 11: 75,772,538 S363P probably damaging Het
Garem1 C T 18: 21,148,435 R288H probably benign Het
Gm15448 G A 7: 3,822,623 L416F probably benign Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Helz2 C A 2: 181,240,508 C164F probably damaging Het
Itfg1 A T 8: 85,766,972 S293T probably benign Het
Kcnn2 T A 18: 45,683,131 D336E probably damaging Het
Kifc2 C T 15: 76,662,153 A245V probably benign Het
Krt18 T A 15: 102,031,300 I311N probably benign Het
Lypla1 T C 1: 4,830,294 M7T possibly damaging Het
Micu1 A C 10: 59,827,306 K353Q possibly damaging Het
Mpv17l A G 16: 13,942,149 probably benign Het
Ntrk1 G A 3: 87,780,172 R652W probably damaging Het
Olfr1212 G A 2: 88,958,641 M58I possibly damaging Het
Olfr155 T C 4: 43,855,152 I281T probably benign Het
Olfr61 T A 7: 140,638,471 F257I probably benign Het
Pcdh15 C A 10: 74,230,259 T252K probably damaging Het
Pcsk5 T C 19: 17,456,829 M1392V probably benign Het
Phf20 T A 2: 156,307,294 V964E probably damaging Het
Plcg2 T C 8: 117,598,495 probably null Het
Pqlc1 C T 18: 80,263,443 P76L probably damaging Het
Rnf10 A T 5: 115,244,068 C693S probably benign Het
Rnf19b A G 4: 129,058,824 Y185C probably damaging Het
Ros1 G T 10: 52,123,289 D1167E probably damaging Het
Sidt2 G A 9: 45,942,199 S701L probably damaging Het
Spag1 T C 15: 36,200,284 I345T probably damaging Het
Srcap T A 7: 127,542,039 S1603T possibly damaging Het
Stag1 T A 9: 100,796,778 Y251N probably damaging Het
Stxbp5 T C 10: 9,900,586 N33S probably benign Het
Tnrc6a T C 7: 123,170,076 L363P probably damaging Het
U2surp C T 9: 95,479,304 R591H possibly damaging Het
Usf3 A G 16: 44,220,746 N1863S possibly damaging Het
Vmn2r15 T C 5: 109,286,940 I633V possibly damaging Het
Zfp979 T C 4: 147,613,610 D214G probably damaging Het
Other mutations in Mef2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01923:Mef2a APN 7 67264872 missense probably damaging 0.98
IGL02112:Mef2a APN 7 67264872 missense probably damaging 0.98
P0024:Mef2a UTSW 7 67295574 missense probably damaging 1.00
R0390:Mef2a UTSW 7 67251724 missense probably damaging 0.96
R0583:Mef2a UTSW 7 67235148 nonsense probably null
R0584:Mef2a UTSW 7 67235148 nonsense probably null
R0589:Mef2a UTSW 7 67235148 nonsense probably null
R0597:Mef2a UTSW 7 67235148 nonsense probably null
R0608:Mef2a UTSW 7 67235148 nonsense probably null
R0704:Mef2a UTSW 7 67235148 nonsense probably null
R1859:Mef2a UTSW 7 67266018 missense probably damaging 0.97
R2166:Mef2a UTSW 7 67266122 missense probably damaging 1.00
R2427:Mef2a UTSW 7 67266060 missense probably damaging 0.98
R3618:Mef2a UTSW 7 67268327 missense probably benign 0.34
R3619:Mef2a UTSW 7 67268327 missense probably benign 0.34
R4576:Mef2a UTSW 7 67240439 missense probably benign 0.00
R4577:Mef2a UTSW 7 67240439 missense probably benign 0.00
R4578:Mef2a UTSW 7 67240439 missense probably benign 0.00
R4635:Mef2a UTSW 7 67240427 missense possibly damaging 0.67
X0011:Mef2a UTSW 7 67235164 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGCATTCTTTCCTAGATAGTC -3'
(R):5'- GGATTTGTAAACTCAAGGGCCTC -3'

Sequencing Primer
(F):5'- TCTAAAGAAAGTTTTCAGCCTGAG -3'
(R):5'- CAAGGGCCTCTCCAAATTTGATTG -3'
Posted On2016-12-15