Incidental Mutation 'R5806:Kcnt2'
ID448478
Institutional Source Beutler Lab
Gene Symbol Kcnt2
Ensembl Gene ENSMUSG00000052726
Gene Namepotassium channel, subfamily T, member 2
SynonymsE330038N15Rik
MMRRC Submission 043392-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R5806 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location140246158-140612067 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 140509496 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 556 (T556P)
Ref Sequence ENSEMBL: ENSMUSP00000113333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119786] [ENSMUST00000120709] [ENSMUST00000120796]
Predicted Effect probably damaging
Transcript: ENSMUST00000119786
AA Change: T506P

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113535
Gene: ENSMUSG00000052726
AA Change: T506P

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.6e-15 PFAM
Pfam:BK_channel_a 422 476 2.3e-16 PFAM
low complexity region 598 613 N/A INTRINSIC
low complexity region 620 632 N/A INTRINSIC
low complexity region 699 714 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120709
AA Change: T556P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112887
Gene: ENSMUSG00000052726
AA Change: T556P

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.7e-15 PFAM
Pfam:BK_channel_a 422 527 1.5e-39 PFAM
low complexity region 648 663 N/A INTRINSIC
low complexity region 670 682 N/A INTRINSIC
low complexity region 749 764 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120796
AA Change: T556P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113333
Gene: ENSMUSG00000052726
AA Change: T556P

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Ion_trans_2 199 282 2.8e-15 PFAM
Pfam:BK_channel_a 422 527 1.5e-39 PFAM
low complexity region 648 663 N/A INTRINSIC
low complexity region 670 682 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145077
SMART Domains Protein: ENSMUSP00000123677
Gene: ENSMUSG00000052726

DomainStartEndE-ValueType
Pfam:BK_channel_a 1 88 1.2e-23 PFAM
low complexity region 209 224 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193606
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable with normal pain and itch responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A G 5: 99,240,872 M216T probably benign Het
Abhd4 A G 14: 54,261,690 N36D probably benign Het
Ankra2 T C 13: 98,268,497 probably null Het
Btd A G 14: 31,667,512 T397A probably benign Het
Ccbe1 T A 18: 66,076,355 K205* probably null Het
Clspn A G 4: 126,586,106 K1081E probably damaging Het
Cmya5 A G 13: 93,093,937 S1548P possibly damaging Het
Coq8b T A 7: 27,250,625 Y376* probably null Het
Cpxm1 C A 2: 130,397,473 A12S probably damaging Het
Cttn T C 7: 144,461,268 T68A probably damaging Het
Cyp2a12 T A 7: 27,029,079 probably null Het
Ddx46 A G 13: 55,663,337 Q582R possibly damaging Het
Ddx55 A G 5: 124,559,199 E208G probably damaging Het
Dync1h1 A T 12: 110,651,653 T3209S probably damaging Het
Dyx1c1 T C 9: 72,962,054 L182P probably benign Het
Ep400 A T 5: 110,755,554 L393* probably null Het
Ern1 G C 11: 106,398,705 S924C probably damaging Het
Fanci T C 7: 79,448,848 I1249T probably damaging Het
Fgfbp3 T G 19: 36,918,549 D223A probably damaging Het
Frmd6 T C 12: 70,890,020 L313P probably damaging Het
Galnt17 A G 5: 130,877,819 Y504H probably damaging Het
Gjb5 A G 4: 127,355,925 I142T probably benign Het
Gvin1 T C 7: 106,158,206 D2352G probably benign Het
H2-M2 G A 17: 37,481,726 T218I probably damaging Het
Hal A G 10: 93,490,984 T161A probably damaging Het
Helb G A 10: 120,092,519 R806C probably damaging Het
Ift80 T A 3: 68,950,476 I279F probably benign Het
Itln1 A T 1: 171,531,152 I149N possibly damaging Het
Klk1b22 A T 7: 44,115,877 E84D possibly damaging Het
Krt78 A G 15: 101,950,502 L305P probably damaging Het
Lzts2 T C 19: 45,026,367 probably benign Het
Macf1 A G 4: 123,371,887 L6843P probably damaging Het
Magi2 C A 5: 20,651,204 H841Q probably benign Het
Mdm1 A T 10: 118,166,658 H628L probably benign Het
Med23 A G 10: 24,907,221 D734G probably damaging Het
Mfsd13a T C 19: 46,366,410 W9R probably benign Het
Mki67 T C 7: 135,704,605 H576R probably damaging Het
Muc5b A G 7: 141,862,835 T3173A possibly damaging Het
Mx1 A T 16: 97,454,151 V234E possibly damaging Het
Myh2 T C 11: 67,181,315 L623P probably damaging Het
Naip1 C T 13: 100,444,735 M1I probably null Het
Ncapd2 A T 6: 125,181,154 V337E probably damaging Het
Nit2 G A 16: 57,161,693 T64M possibly damaging Het
Olfr1195 T C 2: 88,683,151 N194D probably damaging Het
Olfr394 A T 11: 73,887,547 M275K probably damaging Het
Olfr49 A T 14: 54,282,807 F29L probably benign Het
Otub2 A G 12: 103,403,397 E245G probably benign Het
Pde8b T C 13: 95,042,040 K524R probably damaging Het
Pih1d2 C T 9: 50,618,450 probably benign Het
Pik3cg T A 12: 32,204,953 D345V possibly damaging Het
Plekhg4 A T 8: 105,378,910 Q669L possibly damaging Het
Prlr A T 15: 10,319,204 Y73F probably damaging Het
Ptk6 T C 2: 181,199,730 I129V possibly damaging Het
Ranbp3 A T 17: 56,710,717 T458S probably benign Het
Ren1 T A 1: 133,355,511 Y128* probably null Het
Rimkla A T 4: 119,468,466 S249T probably damaging Het
Rnf222 T C 11: 68,892,963 S119P possibly damaging Het
Rrbp1 T A 2: 143,963,331 E1007V probably benign Het
Sept11 G A 5: 93,167,578 E389K probably benign Het
Setbp1 A G 18: 78,856,482 probably null Het
Slc25a54 T C 3: 109,080,578 S12P probably benign Het
Slc26a5 A C 5: 21,823,563 F336V probably damaging Het
Slc5a6 T C 5: 31,040,770 T254A probably damaging Het
Smcr8 G T 11: 60,780,382 probably null Het
Srcap A T 7: 127,559,163 probably benign Het
Srrt A T 5: 137,297,917 I509N probably damaging Het
Tcf25 T A 8: 123,381,504 H99Q probably benign Het
Tmem40 A G 6: 115,736,412 V76A probably benign Het
Tnni3k A T 3: 154,827,611 S740T possibly damaging Het
Top3a A G 11: 60,776,920 probably null Het
Tpd52l2 C A 2: 181,502,887 T109K probably damaging Het
Tsnaxip1 C A 8: 105,837,496 D109E possibly damaging Het
Uty G T Y: 1,170,921 D313E probably damaging Het
Zfp143 A T 7: 110,086,235 K423* probably null Het
Zfp407 C T 18: 84,558,614 G1458D probably damaging Het
Other mutations in Kcnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Kcnt2 APN 1 140523098 missense probably damaging 1.00
IGL00673:Kcnt2 APN 1 140596051 missense possibly damaging 0.60
IGL00806:Kcnt2 APN 1 140523211 missense probably damaging 1.00
IGL01135:Kcnt2 APN 1 140354555 critical splice donor site probably null 0.00
IGL01412:Kcnt2 APN 1 140570417 missense probably benign 0.02
IGL01777:Kcnt2 APN 1 140595998 missense probably benign 0.20
IGL01780:Kcnt2 APN 1 140351269 missense probably benign 0.09
IGL02134:Kcnt2 APN 1 140376383 missense probably benign
IGL02350:Kcnt2 APN 1 140351269 missense probably benign 0.09
IGL02357:Kcnt2 APN 1 140351269 missense probably benign 0.09
IGL02481:Kcnt2 APN 1 140354561 splice site probably benign
IGL02483:Kcnt2 APN 1 140354561 splice site probably benign
IGL02866:Kcnt2 APN 1 140425248 missense probably damaging 1.00
IGL02891:Kcnt2 APN 1 140574806 missense probably damaging 1.00
IGL03007:Kcnt2 APN 1 140354507 missense possibly damaging 0.50
IGL03024:Kcnt2 APN 1 140570455 missense probably benign 0.00
IGL03231:Kcnt2 APN 1 140534002 intron probably benign
R0230:Kcnt2 UTSW 1 140246345 missense probably benign 0.00
R0367:Kcnt2 UTSW 1 140351225 missense probably damaging 1.00
R0486:Kcnt2 UTSW 1 140509480 nonsense probably null
R0543:Kcnt2 UTSW 1 140609614 missense probably damaging 1.00
R0849:Kcnt2 UTSW 1 140507762 missense probably damaging 1.00
R1123:Kcnt2 UTSW 1 140573608 missense probably damaging 1.00
R1156:Kcnt2 UTSW 1 140428855 missense probably damaging 1.00
R1425:Kcnt2 UTSW 1 140383028 missense probably damaging 1.00
R1530:Kcnt2 UTSW 1 140484232 nonsense probably null
R1546:Kcnt2 UTSW 1 140431378 missense probably benign 0.01
R1728:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1729:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1730:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1739:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1762:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1783:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1784:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1785:Kcnt2 UTSW 1 140354547 missense probably benign 0.00
R1862:Kcnt2 UTSW 1 140425330 missense probably damaging 1.00
R1887:Kcnt2 UTSW 1 140584247 missense probably damaging 0.99
R1889:Kcnt2 UTSW 1 140584293 missense probably damaging 1.00
R1894:Kcnt2 UTSW 1 140425341 missense probably damaging 1.00
R2005:Kcnt2 UTSW 1 140553018 missense probably damaging 0.98
R2044:Kcnt2 UTSW 1 140375154 missense probably benign 0.14
R2115:Kcnt2 UTSW 1 140552963 missense probably damaging 1.00
R2135:Kcnt2 UTSW 1 140428813 missense probably damaging 1.00
R2201:Kcnt2 UTSW 1 140509441 missense probably damaging 1.00
R2212:Kcnt2 UTSW 1 140530800 missense probably damaging 1.00
R2267:Kcnt2 UTSW 1 140573683 splice site probably null
R2442:Kcnt2 UTSW 1 140376353 missense possibly damaging 0.59
R3121:Kcnt2 UTSW 1 140428884 missense probably damaging 0.97
R3176:Kcnt2 UTSW 1 140609639 missense probably benign 0.16
R3276:Kcnt2 UTSW 1 140609639 missense probably benign 0.16
R3704:Kcnt2 UTSW 1 140533968 missense probably damaging 1.00
R3944:Kcnt2 UTSW 1 140584287 missense probably damaging 1.00
R4164:Kcnt2 UTSW 1 140609630 missense probably damaging 0.97
R4201:Kcnt2 UTSW 1 140425332 missense probably damaging 0.98
R4501:Kcnt2 UTSW 1 140552980 missense probably damaging 0.99
R4502:Kcnt2 UTSW 1 140507747 missense probably damaging 0.99
R4632:Kcnt2 UTSW 1 140523148 missense possibly damaging 0.90
R4758:Kcnt2 UTSW 1 140518897 missense probably damaging 1.00
R4790:Kcnt2 UTSW 1 140354516 missense probably damaging 0.99
R4892:Kcnt2 UTSW 1 140513025 nonsense probably null
R4973:Kcnt2 UTSW 1 140609650 missense probably damaging 1.00
R5154:Kcnt2 UTSW 1 140351256 missense possibly damaging 0.94
R5296:Kcnt2 UTSW 1 140609615 missense probably damaging 1.00
R5353:Kcnt2 UTSW 1 140426901 missense probably damaging 1.00
R5605:Kcnt2 UTSW 1 140574743 missense possibly damaging 0.59
R5887:Kcnt2 UTSW 1 140425366 missense probably damaging 1.00
R5917:Kcnt2 UTSW 1 140533928 missense probably damaging 0.99
R5961:Kcnt2 UTSW 1 140507702 missense possibly damaging 0.82
R6123:Kcnt2 UTSW 1 140362980 missense probably damaging 1.00
R6225:Kcnt2 UTSW 1 140426923 nonsense probably null
R6248:Kcnt2 UTSW 1 140509478 missense probably damaging 1.00
R6351:Kcnt2 UTSW 1 140375112 missense probably damaging 1.00
R6380:Kcnt2 UTSW 1 140509584 missense probably damaging 1.00
R6532:Kcnt2 UTSW 1 140584106 missense probably damaging 0.97
R6693:Kcnt2 UTSW 1 140351227 missense probably benign 0.00
R6817:Kcnt2 UTSW 1 140246193 unclassified probably benign
R6856:Kcnt2 UTSW 1 140596004 missense probably damaging 1.00
R6944:Kcnt2 UTSW 1 140584065 missense probably benign 0.00
R6971:Kcnt2 UTSW 1 140512908 missense probably benign 0.01
R7052:Kcnt2 UTSW 1 140383047 missense probably damaging 0.99
R7138:Kcnt2 UTSW 1 140596040 missense possibly damaging 0.80
R7261:Kcnt2 UTSW 1 140354517 missense possibly damaging 0.71
R7474:Kcnt2 UTSW 1 140570478 missense possibly damaging 0.84
R7524:Kcnt2 UTSW 1 140584055 missense not run
R7541:Kcnt2 UTSW 1 140376384 missense not run
R7558:Kcnt2 UTSW 1 140523190 missense not run
X0062:Kcnt2 UTSW 1 140512991 missense possibly damaging 0.50
Z1088:Kcnt2 UTSW 1 140573646 missense probably damaging 1.00
Z1088:Kcnt2 UTSW 1 140584158 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCTCCCTAGTTCTATTATTTGATG -3'
(R):5'- CAAGGCAAGCGCTTATAATCAG -3'

Sequencing Primer
(F):5'- AAGAACAAAAAGCTAAGGACTTTTCC -3'
(R):5'- TACTGACCCATGCTGGCAATG -3'
Posted On2016-12-15