Incidental Mutation 'R5806:Slc26a5'
ID448493
Institutional Source Beutler Lab
Gene Symbol Slc26a5
Ensembl Gene ENSMUSG00000029015
Gene Namesolute carrier family 26, member 5
SynonymsPres, prestin
MMRRC Submission 043392-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5806 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location21810655-21865604 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 21823563 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 336 (F336V)
Ref Sequence ENSEMBL: ENSMUSP00000030878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030878] [ENSMUST00000115176] [ENSMUST00000127975] [ENSMUST00000142888]
Predicted Effect probably damaging
Transcript: ENSMUST00000030878
AA Change: F336V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000030878
Gene: ENSMUSG00000029015
AA Change: F336V

DomainStartEndE-ValueType
Pfam:Sulfate_transp 80 475 3.3e-109 PFAM
transmembrane domain 476 498 N/A INTRINSIC
Pfam:STAS 526 709 3.3e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115176
AA Change: F299V

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110830
Gene: ENSMUSG00000029015
AA Change: F299V

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 65 106 5.2e-9 PFAM
Pfam:Sulfate_transp 156 434 1.6e-65 PFAM
transmembrane domain 439 461 N/A INTRINSIC
Pfam:STAS 489 672 1.5e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000127975
AA Change: F336V

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118029
Gene: ENSMUSG00000029015
AA Change: F336V

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 65 148 4.3e-33 PFAM
Pfam:Sulfate_transp 193 440 8.9e-56 PFAM
transmembrane domain 447 469 N/A INTRINSIC
Pfam:STAS 494 677 4.1e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000142888
AA Change: F336V

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118263
Gene: ENSMUSG00000029015
AA Change: F336V

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 65 148 2.1e-33 PFAM
Pfam:Sulfate_transp 193 441 9.6e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150012
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC26A/SulP transporter family. The protein functions as a molecular motor in motile outer hair cells (OHCs) of the cochlea, inducing changes in cell length that act to amplify sound levels. The transmembrane protein is an incomplete anion transporter, and does not allow anions to cross the cell membrane but instead undergoes a conformational change in response to changes in intracellular Cl- levels that results in a change in cell length. The protein functions at microsecond rates, which is several orders of magnitude faster than conventional molecular motor proteins. Mutations in this gene are potential candidates for causing neurosensory deafness. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Nov 2009]
PHENOTYPE: Cochlear sensitivity is decreased in mutant due to a loss of outer hair cell electromotility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A G 5: 99,240,872 M216T probably benign Het
Abhd4 A G 14: 54,261,690 N36D probably benign Het
Ankra2 T C 13: 98,268,497 probably null Het
Btd A G 14: 31,667,512 T397A probably benign Het
Ccbe1 T A 18: 66,076,355 K205* probably null Het
Clspn A G 4: 126,586,106 K1081E probably damaging Het
Cmya5 A G 13: 93,093,937 S1548P possibly damaging Het
Coq8b T A 7: 27,250,625 Y376* probably null Het
Cpxm1 C A 2: 130,397,473 A12S probably damaging Het
Cttn T C 7: 144,461,268 T68A probably damaging Het
Cyp2a12 T A 7: 27,029,079 probably null Het
Ddx46 A G 13: 55,663,337 Q582R possibly damaging Het
Ddx55 A G 5: 124,559,199 E208G probably damaging Het
Dync1h1 A T 12: 110,651,653 T3209S probably damaging Het
Dyx1c1 T C 9: 72,962,054 L182P probably benign Het
Ep400 A T 5: 110,755,554 L393* probably null Het
Ern1 G C 11: 106,398,705 S924C probably damaging Het
Fanci T C 7: 79,448,848 I1249T probably damaging Het
Fgfbp3 T G 19: 36,918,549 D223A probably damaging Het
Frmd6 T C 12: 70,890,020 L313P probably damaging Het
Galnt17 A G 5: 130,877,819 Y504H probably damaging Het
Gjb5 A G 4: 127,355,925 I142T probably benign Het
Gvin1 T C 7: 106,158,206 D2352G probably benign Het
H2-M2 G A 17: 37,481,726 T218I probably damaging Het
Hal A G 10: 93,490,984 T161A probably damaging Het
Helb G A 10: 120,092,519 R806C probably damaging Het
Ift80 T A 3: 68,950,476 I279F probably benign Het
Itln1 A T 1: 171,531,152 I149N possibly damaging Het
Kcnt2 A C 1: 140,509,496 T556P probably damaging Het
Klk1b22 A T 7: 44,115,877 E84D possibly damaging Het
Krt78 A G 15: 101,950,502 L305P probably damaging Het
Lzts2 T C 19: 45,026,367 probably benign Het
Macf1 A G 4: 123,371,887 L6843P probably damaging Het
Magi2 C A 5: 20,651,204 H841Q probably benign Het
Mdm1 A T 10: 118,166,658 H628L probably benign Het
Med23 A G 10: 24,907,221 D734G probably damaging Het
Mfsd13a T C 19: 46,366,410 W9R probably benign Het
Mki67 T C 7: 135,704,605 H576R probably damaging Het
Muc5b A G 7: 141,862,835 T3173A possibly damaging Het
Mx1 A T 16: 97,454,151 V234E possibly damaging Het
Myh2 T C 11: 67,181,315 L623P probably damaging Het
Naip1 C T 13: 100,444,735 M1I probably null Het
Ncapd2 A T 6: 125,181,154 V337E probably damaging Het
Nit2 G A 16: 57,161,693 T64M possibly damaging Het
Olfr1195 T C 2: 88,683,151 N194D probably damaging Het
Olfr394 A T 11: 73,887,547 M275K probably damaging Het
Olfr49 A T 14: 54,282,807 F29L probably benign Het
Otub2 A G 12: 103,403,397 E245G probably benign Het
Pde8b T C 13: 95,042,040 K524R probably damaging Het
Pih1d2 C T 9: 50,618,450 probably benign Het
Pik3cg T A 12: 32,204,953 D345V possibly damaging Het
Plekhg4 A T 8: 105,378,910 Q669L possibly damaging Het
Prlr A T 15: 10,319,204 Y73F probably damaging Het
Ptk6 T C 2: 181,199,730 I129V possibly damaging Het
Ranbp3 A T 17: 56,710,717 T458S probably benign Het
Ren1 T A 1: 133,355,511 Y128* probably null Het
Rimkla A T 4: 119,468,466 S249T probably damaging Het
Rnf222 T C 11: 68,892,963 S119P possibly damaging Het
Rrbp1 T A 2: 143,963,331 E1007V probably benign Het
Sept11 G A 5: 93,167,578 E389K probably benign Het
Setbp1 A G 18: 78,856,482 probably null Het
Slc25a54 T C 3: 109,080,578 S12P probably benign Het
Slc5a6 T C 5: 31,040,770 T254A probably damaging Het
Smcr8 G T 11: 60,780,382 probably null Het
Srcap A T 7: 127,559,163 probably benign Het
Srrt A T 5: 137,297,917 I509N probably damaging Het
Tcf25 T A 8: 123,381,504 H99Q probably benign Het
Tmem40 A G 6: 115,736,412 V76A probably benign Het
Tnni3k A T 3: 154,827,611 S740T possibly damaging Het
Top3a A G 11: 60,776,920 probably null Het
Tpd52l2 C A 2: 181,502,887 T109K probably damaging Het
Tsnaxip1 C A 8: 105,837,496 D109E possibly damaging Het
Uty G T Y: 1,170,921 D313E probably damaging Het
Zfp143 A T 7: 110,086,235 K423* probably null Het
Zfp407 C T 18: 84,558,614 G1458D probably damaging Het
Other mutations in Slc26a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Slc26a5 APN 5 21815736 missense probably damaging 1.00
IGL02486:Slc26a5 APN 5 21846325 missense probably damaging 1.00
IGL02639:Slc26a5 APN 5 21819767 missense probably damaging 1.00
IGL02810:Slc26a5 APN 5 21813383 splice site probably benign
R0002:Slc26a5 UTSW 5 21814983 missense probably damaging 1.00
R0002:Slc26a5 UTSW 5 21814983 missense probably damaging 1.00
R0089:Slc26a5 UTSW 5 21811344 splice site probably null
R0136:Slc26a5 UTSW 5 21834347 missense probably damaging 1.00
R0212:Slc26a5 UTSW 5 21823549 nonsense probably null
R0522:Slc26a5 UTSW 5 21846345 missense probably damaging 0.96
R0557:Slc26a5 UTSW 5 21819764 missense probably damaging 1.00
R0711:Slc26a5 UTSW 5 21847232 missense probably damaging 1.00
R0959:Slc26a5 UTSW 5 21816961 missense probably benign 0.01
R1214:Slc26a5 UTSW 5 21814983 missense probably damaging 1.00
R1471:Slc26a5 UTSW 5 21816964 missense probably benign 0.12
R1647:Slc26a5 UTSW 5 21813976 nonsense probably null
R1648:Slc26a5 UTSW 5 21813976 nonsense probably null
R1861:Slc26a5 UTSW 5 21816958 missense possibly damaging 0.93
R1875:Slc26a5 UTSW 5 21815727 missense probably benign 0.03
R2106:Slc26a5 UTSW 5 21823544 missense probably damaging 1.00
R2169:Slc26a5 UTSW 5 21813865 missense probably damaging 1.00
R2219:Slc26a5 UTSW 5 21823478 missense probably damaging 1.00
R2276:Slc26a5 UTSW 5 21823547 missense probably benign 0.39
R2281:Slc26a5 UTSW 5 21831510 missense possibly damaging 0.94
R2325:Slc26a5 UTSW 5 21819694 missense probably damaging 1.00
R4031:Slc26a5 UTSW 5 21847191 missense probably damaging 1.00
R4793:Slc26a5 UTSW 5 21837994 missense probably damaging 1.00
R4941:Slc26a5 UTSW 5 21820386 missense probably damaging 1.00
R5122:Slc26a5 UTSW 5 21847196 missense probably damaging 1.00
R5274:Slc26a5 UTSW 5 21813901 missense possibly damaging 0.74
R5312:Slc26a5 UTSW 5 21847260 missense probably damaging 0.99
R5628:Slc26a5 UTSW 5 21816976 missense probably benign 0.20
R6227:Slc26a5 UTSW 5 21821097 missense probably damaging 1.00
R6525:Slc26a5 UTSW 5 21820350 missense possibly damaging 0.77
R6609:Slc26a5 UTSW 5 21819719 missense possibly damaging 0.93
R6885:Slc26a5 UTSW 5 21834344 missense probably damaging 1.00
R6974:Slc26a5 UTSW 5 21840572 missense probably damaging 1.00
R7001:Slc26a5 UTSW 5 21811336 missense probably damaging 1.00
R7027:Slc26a5 UTSW 5 21816974 missense possibly damaging 0.60
R7174:Slc26a5 UTSW 5 21813894 missense probably damaging 1.00
R7184:Slc26a5 UTSW 5 21837246 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCCCTTCACTGTGAGAAGC -3'
(R):5'- GGCACCCAGTCTATAGAGATAAC -3'

Sequencing Primer
(F):5'- AACCTGGTAGCCATGCTT -3'
(R):5'- AGAAAGCCGCTCTGCAG -3'
Posted On2016-12-15