Incidental Mutation 'R5806:Slc5a6'
ID448494
Institutional Source Beutler Lab
Gene Symbol Slc5a6
Ensembl Gene ENSMUSG00000006641
Gene Namesolute carrier family 5 (sodium-dependent vitamin transporter), member 6
Synonyms
MMRRC Submission 043392-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5806 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location31036036-31048924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31040770 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 254 (T254A)
Ref Sequence ENSEMBL: ENSMUSP00000143993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080431] [ENSMUST00000114668] [ENSMUST00000200816] [ENSMUST00000202520] [ENSMUST00000202556] [ENSMUST00000202984]
Predicted Effect probably damaging
Transcript: ENSMUST00000006817
AA Change: T254A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006817
Gene: ENSMUSG00000006641
AA Change: T254A

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:SSF 58 462 7.9e-41 PFAM
low complexity region 496 506 N/A INTRINSIC
transmembrane domain 524 546 N/A INTRINSIC
low complexity region 562 573 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000080431
AA Change: T254A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079291
Gene: ENSMUSG00000006641
AA Change: T254A

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:SSF 58 462 7.9e-41 PFAM
low complexity region 496 506 N/A INTRINSIC
transmembrane domain 524 546 N/A INTRINSIC
low complexity region 562 573 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114668
AA Change: T254A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110316
Gene: ENSMUSG00000006641
AA Change: T254A

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:SSF 58 462 7.9e-41 PFAM
low complexity region 496 506 N/A INTRINSIC
transmembrane domain 524 546 N/A INTRINSIC
low complexity region 562 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200816
SMART Domains Protein: ENSMUSP00000144665
Gene: ENSMUSG00000006641

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201017
Predicted Effect probably damaging
Transcript: ENSMUST00000202520
AA Change: T254A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143938
Gene: ENSMUSG00000006641
AA Change: T254A

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:SSF 58 462 7.9e-41 PFAM
low complexity region 496 506 N/A INTRINSIC
transmembrane domain 524 546 N/A INTRINSIC
low complexity region 562 573 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202556
AA Change: T254A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143993
Gene: ENSMUSG00000006641
AA Change: T254A

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:SSF 58 462 7.9e-41 PFAM
low complexity region 496 506 N/A INTRINSIC
transmembrane domain 524 546 N/A INTRINSIC
low complexity region 562 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202984
SMART Domains Protein: ENSMUSP00000144349
Gene: ENSMUSG00000006641

DomainStartEndE-ValueType
Pfam:SSF 2 104 6.3e-15 PFAM
transmembrane domain 158 180 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A G 5: 99,240,872 M216T probably benign Het
Abhd4 A G 14: 54,261,690 N36D probably benign Het
Ankra2 T C 13: 98,268,497 probably null Het
Btd A G 14: 31,667,512 T397A probably benign Het
Ccbe1 T A 18: 66,076,355 K205* probably null Het
Clspn A G 4: 126,586,106 K1081E probably damaging Het
Cmya5 A G 13: 93,093,937 S1548P possibly damaging Het
Coq8b T A 7: 27,250,625 Y376* probably null Het
Cpxm1 C A 2: 130,397,473 A12S probably damaging Het
Cttn T C 7: 144,461,268 T68A probably damaging Het
Cyp2a12 T A 7: 27,029,079 probably null Het
Ddx46 A G 13: 55,663,337 Q582R possibly damaging Het
Ddx55 A G 5: 124,559,199 E208G probably damaging Het
Dync1h1 A T 12: 110,651,653 T3209S probably damaging Het
Dyx1c1 T C 9: 72,962,054 L182P probably benign Het
Ep400 A T 5: 110,755,554 L393* probably null Het
Ern1 G C 11: 106,398,705 S924C probably damaging Het
Fanci T C 7: 79,448,848 I1249T probably damaging Het
Fgfbp3 T G 19: 36,918,549 D223A probably damaging Het
Frmd6 T C 12: 70,890,020 L313P probably damaging Het
Galnt17 A G 5: 130,877,819 Y504H probably damaging Het
Gjb5 A G 4: 127,355,925 I142T probably benign Het
Gvin1 T C 7: 106,158,206 D2352G probably benign Het
H2-M2 G A 17: 37,481,726 T218I probably damaging Het
Hal A G 10: 93,490,984 T161A probably damaging Het
Helb G A 10: 120,092,519 R806C probably damaging Het
Ift80 T A 3: 68,950,476 I279F probably benign Het
Itln1 A T 1: 171,531,152 I149N possibly damaging Het
Kcnt2 A C 1: 140,509,496 T556P probably damaging Het
Klk1b22 A T 7: 44,115,877 E84D possibly damaging Het
Krt78 A G 15: 101,950,502 L305P probably damaging Het
Lzts2 T C 19: 45,026,367 probably benign Het
Macf1 A G 4: 123,371,887 L6843P probably damaging Het
Magi2 C A 5: 20,651,204 H841Q probably benign Het
Mdm1 A T 10: 118,166,658 H628L probably benign Het
Med23 A G 10: 24,907,221 D734G probably damaging Het
Mfsd13a T C 19: 46,366,410 W9R probably benign Het
Mki67 T C 7: 135,704,605 H576R probably damaging Het
Muc5b A G 7: 141,862,835 T3173A possibly damaging Het
Mx1 A T 16: 97,454,151 V234E possibly damaging Het
Myh2 T C 11: 67,181,315 L623P probably damaging Het
Naip1 C T 13: 100,444,735 M1I probably null Het
Ncapd2 A T 6: 125,181,154 V337E probably damaging Het
Nit2 G A 16: 57,161,693 T64M possibly damaging Het
Olfr1195 T C 2: 88,683,151 N194D probably damaging Het
Olfr394 A T 11: 73,887,547 M275K probably damaging Het
Olfr49 A T 14: 54,282,807 F29L probably benign Het
Otub2 A G 12: 103,403,397 E245G probably benign Het
Pde8b T C 13: 95,042,040 K524R probably damaging Het
Pih1d2 C T 9: 50,618,450 probably benign Het
Pik3cg T A 12: 32,204,953 D345V possibly damaging Het
Plekhg4 A T 8: 105,378,910 Q669L possibly damaging Het
Prlr A T 15: 10,319,204 Y73F probably damaging Het
Ptk6 T C 2: 181,199,730 I129V possibly damaging Het
Ranbp3 A T 17: 56,710,717 T458S probably benign Het
Ren1 T A 1: 133,355,511 Y128* probably null Het
Rimkla A T 4: 119,468,466 S249T probably damaging Het
Rnf222 T C 11: 68,892,963 S119P possibly damaging Het
Rrbp1 T A 2: 143,963,331 E1007V probably benign Het
Sept11 G A 5: 93,167,578 E389K probably benign Het
Setbp1 A G 18: 78,856,482 probably null Het
Slc25a54 T C 3: 109,080,578 S12P probably benign Het
Slc26a5 A C 5: 21,823,563 F336V probably damaging Het
Smcr8 G T 11: 60,780,382 probably null Het
Srcap A T 7: 127,559,163 probably benign Het
Srrt A T 5: 137,297,917 I509N probably damaging Het
Tcf25 T A 8: 123,381,504 H99Q probably benign Het
Tmem40 A G 6: 115,736,412 V76A probably benign Het
Tnni3k A T 3: 154,827,611 S740T possibly damaging Het
Top3a A G 11: 60,776,920 probably null Het
Tpd52l2 C A 2: 181,502,887 T109K probably damaging Het
Tsnaxip1 C A 8: 105,837,496 D109E possibly damaging Het
Uty G T Y: 1,170,921 D313E probably damaging Het
Zfp143 A T 7: 110,086,235 K423* probably null Het
Zfp407 C T 18: 84,558,614 G1458D probably damaging Het
Other mutations in Slc5a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Slc5a6 APN 5 31038935 unclassified probably benign
IGL02305:Slc5a6 APN 5 31037835 missense probably benign 0.01
IGL02457:Slc5a6 APN 5 31040658 missense probably damaging 1.00
IGL02691:Slc5a6 APN 5 31042174 missense probably damaging 0.99
IGL02737:Slc5a6 APN 5 31037167 missense probably benign 0.01
IGL03277:Slc5a6 APN 5 31038028 missense possibly damaging 0.90
IGL03389:Slc5a6 APN 5 31037477 missense probably damaging 1.00
Burke UTSW 5 31036884 nonsense probably null
whig UTSW 5 31036811 missense probably damaging 1.00
F5770:Slc5a6 UTSW 5 31042613 unclassified probably null
R1177:Slc5a6 UTSW 5 31039302 critical splice donor site probably null
R1505:Slc5a6 UTSW 5 31037111 missense probably benign 0.00
R1680:Slc5a6 UTSW 5 31042644 missense probably damaging 1.00
R1800:Slc5a6 UTSW 5 31040676 nonsense probably null
R1881:Slc5a6 UTSW 5 31036811 missense probably damaging 1.00
R2216:Slc5a6 UTSW 5 31039335 missense possibly damaging 0.77
R3803:Slc5a6 UTSW 5 31042951 missense probably damaging 1.00
R4250:Slc5a6 UTSW 5 31037718 missense probably benign 0.00
R4765:Slc5a6 UTSW 5 31038083 missense possibly damaging 0.85
R4821:Slc5a6 UTSW 5 31036884 nonsense probably null
R5187:Slc5a6 UTSW 5 31042978 missense probably damaging 1.00
R5536:Slc5a6 UTSW 5 31043102 missense probably damaging 1.00
R5554:Slc5a6 UTSW 5 31038100 missense probably damaging 0.98
R6035:Slc5a6 UTSW 5 31048824 unclassified probably benign
R6035:Slc5a6 UTSW 5 31048824 unclassified probably benign
R6615:Slc5a6 UTSW 5 31036830 missense probably benign
R6621:Slc5a6 UTSW 5 31040778 missense probably damaging 0.98
R6983:Slc5a6 UTSW 5 31040405 missense probably benign
V7581:Slc5a6 UTSW 5 31042613 unclassified probably null
X0022:Slc5a6 UTSW 5 31043338 start codon destroyed probably null 0.97
Predicted Primers PCR Primer
(F):5'- TCCGGAAAGTCCCCAGTAAG -3'
(R):5'- AGGGTTGGGAAAATGGAATCTTCTC -3'

Sequencing Primer
(F):5'- TGAGAAGCCTGAACCCCGTC -3'
(R):5'- GGGAAAATGGAATCTTCTCTCCAAC -3'
Posted On2016-12-15