Incidental Mutation 'R5806:Coq8b'
ID448505
Institutional Source Beutler Lab
Gene Symbol Coq8b
Ensembl Gene ENSMUSG00000003762
Gene Namecoenzyme Q8B
Synonyms0610012P18Rik, Adck4
MMRRC Submission 043392-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5806 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location27233023-27257950 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 27250625 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 376 (Y376*)
Ref Sequence ENSEMBL: ENSMUSP00000104015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003860] [ENSMUST00000108378] [ENSMUST00000128090]
Predicted Effect probably null
Transcript: ENSMUST00000003860
AA Change: Y376*
SMART Domains Protein: ENSMUSP00000003860
Gene: ENSMUSG00000003762
AA Change: Y376*

DomainStartEndE-ValueType
low complexity region 93 109 N/A INTRINSIC
Pfam:ABC1 198 314 4.9e-34 PFAM
low complexity region 348 364 N/A INTRINSIC
low complexity region 474 483 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108378
AA Change: Y376*
SMART Domains Protein: ENSMUSP00000104015
Gene: ENSMUSG00000003762
AA Change: Y376*

DomainStartEndE-ValueType
low complexity region 93 109 N/A INTRINSIC
Pfam:ABC1 198 314 4.4e-34 PFAM
low complexity region 348 364 N/A INTRINSIC
low complexity region 474 483 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123012
Predicted Effect probably benign
Transcript: ENSMUST00000128090
SMART Domains Protein: ENSMUSP00000123309
Gene: ENSMUSG00000003762

DomainStartEndE-ValueType
low complexity region 93 109 N/A INTRINSIC
Pfam:ABC1 198 304 3.4e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152342
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two copies of a domain found in protein kinases. The encoded protein has a complete protein kinase catalytic domain, and a truncated domain that contains only the active and binding sites of the protein kinase domain, however, it is not known whether the protein has any kinase activity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A G 5: 99,240,872 M216T probably benign Het
Abhd4 A G 14: 54,261,690 N36D probably benign Het
Ankra2 T C 13: 98,268,497 probably null Het
Btd A G 14: 31,667,512 T397A probably benign Het
Ccbe1 T A 18: 66,076,355 K205* probably null Het
Clspn A G 4: 126,586,106 K1081E probably damaging Het
Cmya5 A G 13: 93,093,937 S1548P possibly damaging Het
Cpxm1 C A 2: 130,397,473 A12S probably damaging Het
Cttn T C 7: 144,461,268 T68A probably damaging Het
Cyp2a12 T A 7: 27,029,079 probably null Het
Ddx46 A G 13: 55,663,337 Q582R possibly damaging Het
Ddx55 A G 5: 124,559,199 E208G probably damaging Het
Dync1h1 A T 12: 110,651,653 T3209S probably damaging Het
Dyx1c1 T C 9: 72,962,054 L182P probably benign Het
Ep400 A T 5: 110,755,554 L393* probably null Het
Ern1 G C 11: 106,398,705 S924C probably damaging Het
Fanci T C 7: 79,448,848 I1249T probably damaging Het
Fgfbp3 T G 19: 36,918,549 D223A probably damaging Het
Frmd6 T C 12: 70,890,020 L313P probably damaging Het
Galnt17 A G 5: 130,877,819 Y504H probably damaging Het
Gjb5 A G 4: 127,355,925 I142T probably benign Het
Gvin1 T C 7: 106,158,206 D2352G probably benign Het
H2-M2 G A 17: 37,481,726 T218I probably damaging Het
Hal A G 10: 93,490,984 T161A probably damaging Het
Helb G A 10: 120,092,519 R806C probably damaging Het
Ift80 T A 3: 68,950,476 I279F probably benign Het
Itln1 A T 1: 171,531,152 I149N possibly damaging Het
Kcnt2 A C 1: 140,509,496 T556P probably damaging Het
Klk1b22 A T 7: 44,115,877 E84D possibly damaging Het
Krt78 A G 15: 101,950,502 L305P probably damaging Het
Lzts2 T C 19: 45,026,367 probably benign Het
Macf1 A G 4: 123,371,887 L6843P probably damaging Het
Magi2 C A 5: 20,651,204 H841Q probably benign Het
Mdm1 A T 10: 118,166,658 H628L probably benign Het
Med23 A G 10: 24,907,221 D734G probably damaging Het
Mfsd13a T C 19: 46,366,410 W9R probably benign Het
Mki67 T C 7: 135,704,605 H576R probably damaging Het
Muc5b A G 7: 141,862,835 T3173A possibly damaging Het
Mx1 A T 16: 97,454,151 V234E possibly damaging Het
Myh2 T C 11: 67,181,315 L623P probably damaging Het
Naip1 C T 13: 100,444,735 M1I probably null Het
Ncapd2 A T 6: 125,181,154 V337E probably damaging Het
Nit2 G A 16: 57,161,693 T64M possibly damaging Het
Olfr1195 T C 2: 88,683,151 N194D probably damaging Het
Olfr394 A T 11: 73,887,547 M275K probably damaging Het
Olfr49 A T 14: 54,282,807 F29L probably benign Het
Otub2 A G 12: 103,403,397 E245G probably benign Het
Pde8b T C 13: 95,042,040 K524R probably damaging Het
Pih1d2 C T 9: 50,618,450 probably benign Het
Pik3cg T A 12: 32,204,953 D345V possibly damaging Het
Plekhg4 A T 8: 105,378,910 Q669L possibly damaging Het
Prlr A T 15: 10,319,204 Y73F probably damaging Het
Ptk6 T C 2: 181,199,730 I129V possibly damaging Het
Ranbp3 A T 17: 56,710,717 T458S probably benign Het
Ren1 T A 1: 133,355,511 Y128* probably null Het
Rimkla A T 4: 119,468,466 S249T probably damaging Het
Rnf222 T C 11: 68,892,963 S119P possibly damaging Het
Rrbp1 T A 2: 143,963,331 E1007V probably benign Het
Sept11 G A 5: 93,167,578 E389K probably benign Het
Setbp1 A G 18: 78,856,482 probably null Het
Slc25a54 T C 3: 109,080,578 S12P probably benign Het
Slc26a5 A C 5: 21,823,563 F336V probably damaging Het
Slc5a6 T C 5: 31,040,770 T254A probably damaging Het
Smcr8 G T 11: 60,780,382 probably null Het
Srcap A T 7: 127,559,163 probably benign Het
Srrt A T 5: 137,297,917 I509N probably damaging Het
Tcf25 T A 8: 123,381,504 H99Q probably benign Het
Tmem40 A G 6: 115,736,412 V76A probably benign Het
Tnni3k A T 3: 154,827,611 S740T possibly damaging Het
Top3a A G 11: 60,776,920 probably null Het
Tpd52l2 C A 2: 181,502,887 T109K probably damaging Het
Tsnaxip1 C A 8: 105,837,496 D109E possibly damaging Het
Uty G T Y: 1,170,921 D313E probably damaging Het
Zfp143 A T 7: 110,086,235 K423* probably null Het
Zfp407 C T 18: 84,558,614 G1458D probably damaging Het
Other mutations in Coq8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Coq8b APN 7 27257477 missense probably benign
IGL01116:Coq8b APN 7 27239857 missense possibly damaging 0.82
IGL01123:Coq8b APN 7 27240084 missense probably damaging 1.00
IGL02949:Coq8b APN 7 27256613 missense possibly damaging 0.70
R0067:Coq8b UTSW 7 27233481 missense possibly damaging 0.87
R0690:Coq8b UTSW 7 27242249 missense probably benign 0.15
R1307:Coq8b UTSW 7 27250591 missense probably damaging 1.00
R1470:Coq8b UTSW 7 27252309 missense probably benign 0.10
R1470:Coq8b UTSW 7 27252309 missense probably benign 0.10
R1551:Coq8b UTSW 7 27257482 missense probably damaging 1.00
R1682:Coq8b UTSW 7 27240124 missense probably benign 0.00
R1895:Coq8b UTSW 7 27239874 missense possibly damaging 0.91
R1945:Coq8b UTSW 7 27233980 small insertion probably benign
R1945:Coq8b UTSW 7 27233981 small insertion probably benign
R1946:Coq8b UTSW 7 27239874 missense possibly damaging 0.91
R2069:Coq8b UTSW 7 27257377 missense probably damaging 1.00
R3758:Coq8b UTSW 7 27242227 nonsense probably null
R4545:Coq8b UTSW 7 27233505 missense probably benign 0.45
R4838:Coq8b UTSW 7 27250591 missense probably damaging 1.00
R5181:Coq8b UTSW 7 27252322 missense possibly damaging 0.65
R5345:Coq8b UTSW 7 27250348 missense probably benign
R5943:Coq8b UTSW 7 27234003 missense probably damaging 1.00
R6005:Coq8b UTSW 7 27257325 nonsense probably null
R7028:Coq8b UTSW 7 27239868 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCTCCTTGTGGAACGGG -3'
(R):5'- TGTATTACATTATGTGTGGCCCATG -3'

Sequencing Primer
(F):5'- TCCTTGTGGAACGGGACCAG -3'
(R):5'- GGGGTCAGATGATATTCCTTCCC -3'
Posted On2016-12-15