Incidental Mutation 'R5806:Cttn'
ID448513
Institutional Source Beutler Lab
Gene Symbol Cttn
Ensembl Gene ENSMUSG00000031078
Gene Namecortactin
SynonymsEms1, 1110020L01Rik
MMRRC Submission 043392-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.257) question?
Stock #R5806 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location144435733-144471009 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144461268 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 68 (T68A)
Ref Sequence ENSEMBL: ENSMUSP00000033407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033407] [ENSMUST00000103079]
Predicted Effect probably damaging
Transcript: ENSMUST00000033407
AA Change: T68A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033407
Gene: ENSMUSG00000031078
AA Change: T68A

DomainStartEndE-ValueType
Pfam:HS1_rep 83 119 1.3e-22 PFAM
Pfam:HS1_rep 120 156 8.6e-25 PFAM
Pfam:HS1_rep 157 193 3.4e-25 PFAM
Pfam:HS1_rep 194 230 1.9e-23 PFAM
Pfam:HS1_rep 231 267 1.2e-24 PFAM
Pfam:HS1_rep 268 293 2.4e-10 PFAM
coiled coil region 311 364 N/A INTRINSIC
SH3 454 509 6.84e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103079
AA Change: T68A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000099368
Gene: ENSMUSG00000031078
AA Change: T68A

DomainStartEndE-ValueType
Pfam:HS1_rep 83 118 2.7e-22 PFAM
Pfam:HS1_rep 120 155 2.9e-23 PFAM
Pfam:HS1_rep 157 192 8.2e-24 PFAM
Pfam:HS1_rep 194 229 7.5e-22 PFAM
Pfam:HS1_rep 231 266 6.6e-25 PFAM
Pfam:HS1_rep 268 303 2.3e-22 PFAM
Pfam:HS1_rep 305 332 4.3e-13 PFAM
coiled coil region 348 401 N/A INTRINSIC
SH3 491 546 6.84e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148778
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is overexpressed in breast cancer and squamous cell carcinomas of the head and neck. The encoded protein is localized in the cytoplasm and in areas of the cell-substratum contacts. This gene has two roles: (1) regulating the interactions between components of adherens-type junctions and (2) organizing the cytoskeleton and cell adhesion structures of epithelia and carcinoma cells. During apoptosis, the encoded protein is degraded in a caspase-dependent manner. The aberrant regulation of this gene contributes to tumor cell invasion and metastasis. Three splice variants that encode different isoforms have been identified for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit abnormal early zygote development and die prior to the 2-cell stage. Mice homozygous for a different knock-out allele exhibit increased permeability in vascular and lung endothelial cells and impaired neutrophil extravasation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A G 5: 99,240,872 M216T probably benign Het
Abhd4 A G 14: 54,261,690 N36D probably benign Het
Ankra2 T C 13: 98,268,497 probably null Het
Btd A G 14: 31,667,512 T397A probably benign Het
Ccbe1 T A 18: 66,076,355 K205* probably null Het
Clspn A G 4: 126,586,106 K1081E probably damaging Het
Cmya5 A G 13: 93,093,937 S1548P possibly damaging Het
Coq8b T A 7: 27,250,625 Y376* probably null Het
Cpxm1 C A 2: 130,397,473 A12S probably damaging Het
Cyp2a12 T A 7: 27,029,079 probably null Het
Ddx46 A G 13: 55,663,337 Q582R possibly damaging Het
Ddx55 A G 5: 124,559,199 E208G probably damaging Het
Dync1h1 A T 12: 110,651,653 T3209S probably damaging Het
Dyx1c1 T C 9: 72,962,054 L182P probably benign Het
Ep400 A T 5: 110,755,554 L393* probably null Het
Ern1 G C 11: 106,398,705 S924C probably damaging Het
Fanci T C 7: 79,448,848 I1249T probably damaging Het
Fgfbp3 T G 19: 36,918,549 D223A probably damaging Het
Frmd6 T C 12: 70,890,020 L313P probably damaging Het
Galnt17 A G 5: 130,877,819 Y504H probably damaging Het
Gjb5 A G 4: 127,355,925 I142T probably benign Het
Gvin1 T C 7: 106,158,206 D2352G probably benign Het
H2-M2 G A 17: 37,481,726 T218I probably damaging Het
Hal A G 10: 93,490,984 T161A probably damaging Het
Helb G A 10: 120,092,519 R806C probably damaging Het
Ift80 T A 3: 68,950,476 I279F probably benign Het
Itln1 A T 1: 171,531,152 I149N possibly damaging Het
Kcnt2 A C 1: 140,509,496 T556P probably damaging Het
Klk1b22 A T 7: 44,115,877 E84D possibly damaging Het
Krt78 A G 15: 101,950,502 L305P probably damaging Het
Lzts2 T C 19: 45,026,367 probably benign Het
Macf1 A G 4: 123,371,887 L6843P probably damaging Het
Magi2 C A 5: 20,651,204 H841Q probably benign Het
Mdm1 A T 10: 118,166,658 H628L probably benign Het
Med23 A G 10: 24,907,221 D734G probably damaging Het
Mfsd13a T C 19: 46,366,410 W9R probably benign Het
Mki67 T C 7: 135,704,605 H576R probably damaging Het
Muc5b A G 7: 141,862,835 T3173A possibly damaging Het
Mx1 A T 16: 97,454,151 V234E possibly damaging Het
Myh2 T C 11: 67,181,315 L623P probably damaging Het
Naip1 C T 13: 100,444,735 M1I probably null Het
Ncapd2 A T 6: 125,181,154 V337E probably damaging Het
Nit2 G A 16: 57,161,693 T64M possibly damaging Het
Olfr1195 T C 2: 88,683,151 N194D probably damaging Het
Olfr394 A T 11: 73,887,547 M275K probably damaging Het
Olfr49 A T 14: 54,282,807 F29L probably benign Het
Otub2 A G 12: 103,403,397 E245G probably benign Het
Pde8b T C 13: 95,042,040 K524R probably damaging Het
Pih1d2 C T 9: 50,618,450 probably benign Het
Pik3cg T A 12: 32,204,953 D345V possibly damaging Het
Plekhg4 A T 8: 105,378,910 Q669L possibly damaging Het
Prlr A T 15: 10,319,204 Y73F probably damaging Het
Ptk6 T C 2: 181,199,730 I129V possibly damaging Het
Ranbp3 A T 17: 56,710,717 T458S probably benign Het
Ren1 T A 1: 133,355,511 Y128* probably null Het
Rimkla A T 4: 119,468,466 S249T probably damaging Het
Rnf222 T C 11: 68,892,963 S119P possibly damaging Het
Rrbp1 T A 2: 143,963,331 E1007V probably benign Het
Sept11 G A 5: 93,167,578 E389K probably benign Het
Setbp1 A G 18: 78,856,482 probably null Het
Slc25a54 T C 3: 109,080,578 S12P probably benign Het
Slc26a5 A C 5: 21,823,563 F336V probably damaging Het
Slc5a6 T C 5: 31,040,770 T254A probably damaging Het
Smcr8 G T 11: 60,780,382 probably null Het
Srcap A T 7: 127,559,163 probably benign Het
Srrt A T 5: 137,297,917 I509N probably damaging Het
Tcf25 T A 8: 123,381,504 H99Q probably benign Het
Tmem40 A G 6: 115,736,412 V76A probably benign Het
Tnni3k A T 3: 154,827,611 S740T possibly damaging Het
Top3a A G 11: 60,776,920 probably null Het
Tpd52l2 C A 2: 181,502,887 T109K probably damaging Het
Tsnaxip1 C A 8: 105,837,496 D109E possibly damaging Het
Uty G T Y: 1,170,921 D313E probably damaging Het
Zfp143 A T 7: 110,086,235 K423* probably null Het
Zfp407 C T 18: 84,558,614 G1458D probably damaging Het
Other mutations in Cttn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:Cttn APN 7 144457727 missense probably damaging 0.99
IGL01432:Cttn APN 7 144461306 missense probably damaging 0.98
IGL02652:Cttn APN 7 144441731 missense probably benign 0.00
PIT4377001:Cttn UTSW 7 144440096 missense possibly damaging 0.71
R0226:Cttn UTSW 7 144441852 splice site probably benign
R0346:Cttn UTSW 7 144452539 splice site probably benign
R1220:Cttn UTSW 7 144463962 missense probably benign
R3807:Cttn UTSW 7 144445851 missense probably damaging 1.00
R4080:Cttn UTSW 7 144457724 missense probably damaging 1.00
R4578:Cttn UTSW 7 144454716 missense probably damaging 1.00
R6835:Cttn UTSW 7 144456497 critical splice acceptor site probably null
R6985:Cttn UTSW 7 144452587 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTATAGAAGACCCCTCAGAGC -3'
(R):5'- CACATACAGAGCCTTGGAGG -3'

Sequencing Primer
(F):5'- CCCCACTCTACACTATGACTCAGG -3'
(R):5'- CTTGGAGGCAGGCACAGTG -3'
Posted On2016-12-15