Incidental Mutation 'R5806:Tcf25'
ID448517
Institutional Source Beutler Lab
Gene Symbol Tcf25
Ensembl Gene ENSMUSG00000001472
Gene Nametranscription factor 25 (basic helix-loop-helix)
Synonyms1100001J13Rik, Nulp1, D8Ertd325e, 1810041K11Rik
MMRRC Submission 043392-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5806 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location123373753-123403835 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123381504 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 99 (H99Q)
Ref Sequence ENSEMBL: ENSMUSP00000148676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057934] [ENSMUST00000108840] [ENSMUST00000127664] [ENSMUST00000211932] [ENSMUST00000212470] [ENSMUST00000212569] [ENSMUST00000212571]
Predicted Effect probably benign
Transcript: ENSMUST00000057934
AA Change: H99Q

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000056485
Gene: ENSMUSG00000001472
AA Change: H99Q

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 34 55 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
Pfam:Tcf25 248 588 4.6e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108840
AA Change: H99Q

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000104468
Gene: ENSMUSG00000001472
AA Change: H99Q

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 34 55 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
Pfam:Tcf25 247 588 2.3e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211932
AA Change: H99Q

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211964
Predicted Effect probably benign
Transcript: ENSMUST00000212470
AA Change: H99Q

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212498
Predicted Effect probably benign
Transcript: ENSMUST00000212569
AA Change: H99Q

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000212571
AA Change: H99Q

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TCF25 is a member of the basic helix-loop-helix (bHLH) family of transcription factors that are important in embryonic development (Steen and Lindholm, 2008 [PubMed 18068114]).[supplied by OMIM, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A G 5: 99,240,872 M216T probably benign Het
Abhd4 A G 14: 54,261,690 N36D probably benign Het
Ankra2 T C 13: 98,268,497 probably null Het
Btd A G 14: 31,667,512 T397A probably benign Het
Ccbe1 T A 18: 66,076,355 K205* probably null Het
Clspn A G 4: 126,586,106 K1081E probably damaging Het
Cmya5 A G 13: 93,093,937 S1548P possibly damaging Het
Coq8b T A 7: 27,250,625 Y376* probably null Het
Cpxm1 C A 2: 130,397,473 A12S probably damaging Het
Cttn T C 7: 144,461,268 T68A probably damaging Het
Cyp2a12 T A 7: 27,029,079 probably null Het
Ddx46 A G 13: 55,663,337 Q582R possibly damaging Het
Ddx55 A G 5: 124,559,199 E208G probably damaging Het
Dync1h1 A T 12: 110,651,653 T3209S probably damaging Het
Dyx1c1 T C 9: 72,962,054 L182P probably benign Het
Ep400 A T 5: 110,755,554 L393* probably null Het
Ern1 G C 11: 106,398,705 S924C probably damaging Het
Fanci T C 7: 79,448,848 I1249T probably damaging Het
Fgfbp3 T G 19: 36,918,549 D223A probably damaging Het
Frmd6 T C 12: 70,890,020 L313P probably damaging Het
Galnt17 A G 5: 130,877,819 Y504H probably damaging Het
Gjb5 A G 4: 127,355,925 I142T probably benign Het
Gvin1 T C 7: 106,158,206 D2352G probably benign Het
H2-M2 G A 17: 37,481,726 T218I probably damaging Het
Hal A G 10: 93,490,984 T161A probably damaging Het
Helb G A 10: 120,092,519 R806C probably damaging Het
Ift80 T A 3: 68,950,476 I279F probably benign Het
Itln1 A T 1: 171,531,152 I149N possibly damaging Het
Kcnt2 A C 1: 140,509,496 T556P probably damaging Het
Klk1b22 A T 7: 44,115,877 E84D possibly damaging Het
Krt78 A G 15: 101,950,502 L305P probably damaging Het
Lzts2 T C 19: 45,026,367 probably benign Het
Macf1 A G 4: 123,371,887 L6843P probably damaging Het
Magi2 C A 5: 20,651,204 H841Q probably benign Het
Mdm1 A T 10: 118,166,658 H628L probably benign Het
Med23 A G 10: 24,907,221 D734G probably damaging Het
Mfsd13a T C 19: 46,366,410 W9R probably benign Het
Mki67 T C 7: 135,704,605 H576R probably damaging Het
Muc5b A G 7: 141,862,835 T3173A possibly damaging Het
Mx1 A T 16: 97,454,151 V234E possibly damaging Het
Myh2 T C 11: 67,181,315 L623P probably damaging Het
Naip1 C T 13: 100,444,735 M1I probably null Het
Ncapd2 A T 6: 125,181,154 V337E probably damaging Het
Nit2 G A 16: 57,161,693 T64M possibly damaging Het
Olfr1195 T C 2: 88,683,151 N194D probably damaging Het
Olfr394 A T 11: 73,887,547 M275K probably damaging Het
Olfr49 A T 14: 54,282,807 F29L probably benign Het
Otub2 A G 12: 103,403,397 E245G probably benign Het
Pde8b T C 13: 95,042,040 K524R probably damaging Het
Pih1d2 C T 9: 50,618,450 probably benign Het
Pik3cg T A 12: 32,204,953 D345V possibly damaging Het
Plekhg4 A T 8: 105,378,910 Q669L possibly damaging Het
Prlr A T 15: 10,319,204 Y73F probably damaging Het
Ptk6 T C 2: 181,199,730 I129V possibly damaging Het
Ranbp3 A T 17: 56,710,717 T458S probably benign Het
Ren1 T A 1: 133,355,511 Y128* probably null Het
Rimkla A T 4: 119,468,466 S249T probably damaging Het
Rnf222 T C 11: 68,892,963 S119P possibly damaging Het
Rrbp1 T A 2: 143,963,331 E1007V probably benign Het
Sept11 G A 5: 93,167,578 E389K probably benign Het
Setbp1 A G 18: 78,856,482 probably null Het
Slc25a54 T C 3: 109,080,578 S12P probably benign Het
Slc26a5 A C 5: 21,823,563 F336V probably damaging Het
Slc5a6 T C 5: 31,040,770 T254A probably damaging Het
Smcr8 G T 11: 60,780,382 probably null Het
Srcap A T 7: 127,559,163 probably benign Het
Srrt A T 5: 137,297,917 I509N probably damaging Het
Tmem40 A G 6: 115,736,412 V76A probably benign Het
Tnni3k A T 3: 154,827,611 S740T possibly damaging Het
Top3a A G 11: 60,776,920 probably null Het
Tpd52l2 C A 2: 181,502,887 T109K probably damaging Het
Tsnaxip1 C A 8: 105,837,496 D109E possibly damaging Het
Uty G T Y: 1,170,921 D313E probably damaging Het
Zfp143 A T 7: 110,086,235 K423* probably null Het
Zfp407 C T 18: 84,558,614 G1458D probably damaging Het
Other mutations in Tcf25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01790:Tcf25 APN 8 123393236 missense possibly damaging 0.87
IGL02638:Tcf25 APN 8 123399292 missense probably damaging 1.00
IGL03112:Tcf25 APN 8 123382519 splice site probably benign
R0492:Tcf25 UTSW 8 123381464 missense probably benign 0.00
R1081:Tcf25 UTSW 8 123381473 missense probably benign 0.00
R1543:Tcf25 UTSW 8 123388587 missense probably benign 0.01
R1634:Tcf25 UTSW 8 123397091 missense possibly damaging 0.68
R1662:Tcf25 UTSW 8 123381550 missense probably benign 0.00
R2253:Tcf25 UTSW 8 123374033 missense probably benign 0.21
R4326:Tcf25 UTSW 8 123401143 nonsense probably null
R4327:Tcf25 UTSW 8 123401143 nonsense probably null
R4667:Tcf25 UTSW 8 123397025 missense possibly damaging 0.89
R4977:Tcf25 UTSW 8 123388635 missense probably benign 0.03
R5248:Tcf25 UTSW 8 123373939 missense probably damaging 1.00
R5249:Tcf25 UTSW 8 123388633 missense probably damaging 1.00
R5759:Tcf25 UTSW 8 123381457 missense probably benign 0.00
R5813:Tcf25 UTSW 8 123395615 unclassified probably null
R5905:Tcf25 UTSW 8 123381437 missense possibly damaging 0.78
R6028:Tcf25 UTSW 8 123381437 missense possibly damaging 0.78
R6114:Tcf25 UTSW 8 123384375 missense probably damaging 1.00
R6349:Tcf25 UTSW 8 123391593 missense probably damaging 1.00
R6904:Tcf25 UTSW 8 123400698 critical splice donor site probably null
R7232:Tcf25 UTSW 8 123401061 splice site probably null
R7287:Tcf25 UTSW 8 123373972 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- ACTGCCCTCTGTGGTTTCAG -3'
(R):5'- TGGCCTTCAGATTTCTACAGG -3'

Sequencing Primer
(F):5'- TTTCAGCTGGACGGAGCCTC -3'
(R):5'- TGGCCTTCAGATTTCTACAGGAAACC -3'
Posted On2016-12-15