Incidental Mutation 'R5806:Med23'
ID448521
Institutional Source Beutler Lab
Gene Symbol Med23
Ensembl Gene ENSMUSG00000019984
Gene Namemediator complex subunit 23
SynonymsX83317, 3000002A17Rik, ESTM7, Crsp3, Sur2
MMRRC Submission 043392-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5806 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location24869986-24913681 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24907221 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 734 (D734G)
Ref Sequence ENSEMBL: ENSMUSP00000135232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000092646] [ENSMUST00000176285] [ENSMUST00000177232]
Predicted Effect probably damaging
Transcript: ENSMUST00000020159
AA Change: D1094G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984
AA Change: D1094G

DomainStartEndE-ValueType
Pfam:Med23 3 1310 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092646
AA Change: D1100G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984
AA Change: D1100G

DomainStartEndE-ValueType
Pfam:Med23 4 1316 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176285
AA Change: D734G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984
AA Change: D734G

DomainStartEndE-ValueType
Pfam:Med23 1 51 4.4e-14 PFAM
Pfam:Med23 48 950 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177232
SMART Domains Protein: ENSMUSP00000134866
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 3 58 1.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184228
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A G 5: 99,240,872 M216T probably benign Het
Abhd4 A G 14: 54,261,690 N36D probably benign Het
Ankra2 T C 13: 98,268,497 probably null Het
Btd A G 14: 31,667,512 T397A probably benign Het
Ccbe1 T A 18: 66,076,355 K205* probably null Het
Clspn A G 4: 126,586,106 K1081E probably damaging Het
Cmya5 A G 13: 93,093,937 S1548P possibly damaging Het
Coq8b T A 7: 27,250,625 Y376* probably null Het
Cpxm1 C A 2: 130,397,473 A12S probably damaging Het
Cttn T C 7: 144,461,268 T68A probably damaging Het
Cyp2a12 T A 7: 27,029,079 probably null Het
Ddx46 A G 13: 55,663,337 Q582R possibly damaging Het
Ddx55 A G 5: 124,559,199 E208G probably damaging Het
Dync1h1 A T 12: 110,651,653 T3209S probably damaging Het
Dyx1c1 T C 9: 72,962,054 L182P probably benign Het
Ep400 A T 5: 110,755,554 L393* probably null Het
Ern1 G C 11: 106,398,705 S924C probably damaging Het
Fanci T C 7: 79,448,848 I1249T probably damaging Het
Fgfbp3 T G 19: 36,918,549 D223A probably damaging Het
Frmd6 T C 12: 70,890,020 L313P probably damaging Het
Galnt17 A G 5: 130,877,819 Y504H probably damaging Het
Gjb5 A G 4: 127,355,925 I142T probably benign Het
Gvin1 T C 7: 106,158,206 D2352G probably benign Het
H2-M2 G A 17: 37,481,726 T218I probably damaging Het
Hal A G 10: 93,490,984 T161A probably damaging Het
Helb G A 10: 120,092,519 R806C probably damaging Het
Ift80 T A 3: 68,950,476 I279F probably benign Het
Itln1 A T 1: 171,531,152 I149N possibly damaging Het
Kcnt2 A C 1: 140,509,496 T556P probably damaging Het
Klk1b22 A T 7: 44,115,877 E84D possibly damaging Het
Krt78 A G 15: 101,950,502 L305P probably damaging Het
Lzts2 T C 19: 45,026,367 probably benign Het
Macf1 A G 4: 123,371,887 L6843P probably damaging Het
Magi2 C A 5: 20,651,204 H841Q probably benign Het
Mdm1 A T 10: 118,166,658 H628L probably benign Het
Mfsd13a T C 19: 46,366,410 W9R probably benign Het
Mki67 T C 7: 135,704,605 H576R probably damaging Het
Muc5b A G 7: 141,862,835 T3173A possibly damaging Het
Mx1 A T 16: 97,454,151 V234E possibly damaging Het
Myh2 T C 11: 67,181,315 L623P probably damaging Het
Naip1 C T 13: 100,444,735 M1I probably null Het
Ncapd2 A T 6: 125,181,154 V337E probably damaging Het
Nit2 G A 16: 57,161,693 T64M possibly damaging Het
Olfr1195 T C 2: 88,683,151 N194D probably damaging Het
Olfr394 A T 11: 73,887,547 M275K probably damaging Het
Olfr49 A T 14: 54,282,807 F29L probably benign Het
Otub2 A G 12: 103,403,397 E245G probably benign Het
Pde8b T C 13: 95,042,040 K524R probably damaging Het
Pih1d2 C T 9: 50,618,450 probably benign Het
Pik3cg T A 12: 32,204,953 D345V possibly damaging Het
Plekhg4 A T 8: 105,378,910 Q669L possibly damaging Het
Prlr A T 15: 10,319,204 Y73F probably damaging Het
Ptk6 T C 2: 181,199,730 I129V possibly damaging Het
Ranbp3 A T 17: 56,710,717 T458S probably benign Het
Ren1 T A 1: 133,355,511 Y128* probably null Het
Rimkla A T 4: 119,468,466 S249T probably damaging Het
Rnf222 T C 11: 68,892,963 S119P possibly damaging Het
Rrbp1 T A 2: 143,963,331 E1007V probably benign Het
Sept11 G A 5: 93,167,578 E389K probably benign Het
Setbp1 A G 18: 78,856,482 probably null Het
Slc25a54 T C 3: 109,080,578 S12P probably benign Het
Slc26a5 A C 5: 21,823,563 F336V probably damaging Het
Slc5a6 T C 5: 31,040,770 T254A probably damaging Het
Smcr8 G T 11: 60,780,382 probably null Het
Srcap A T 7: 127,559,163 probably benign Het
Srrt A T 5: 137,297,917 I509N probably damaging Het
Tcf25 T A 8: 123,381,504 H99Q probably benign Het
Tmem40 A G 6: 115,736,412 V76A probably benign Het
Tnni3k A T 3: 154,827,611 S740T possibly damaging Het
Top3a A G 11: 60,776,920 probably null Het
Tpd52l2 C A 2: 181,502,887 T109K probably damaging Het
Tsnaxip1 C A 8: 105,837,496 D109E possibly damaging Het
Uty G T Y: 1,170,921 D313E probably damaging Het
Zfp143 A T 7: 110,086,235 K423* probably null Het
Zfp407 C T 18: 84,558,614 G1458D probably damaging Het
Other mutations in Med23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Med23 APN 10 24888584 missense probably damaging 1.00
IGL00792:Med23 APN 10 24877004 missense possibly damaging 0.93
IGL01289:Med23 APN 10 24902121 missense probably damaging 1.00
IGL01469:Med23 APN 10 24882597 missense probably damaging 1.00
IGL01598:Med23 APN 10 24903798 missense probably benign 0.34
IGL02324:Med23 APN 10 24897341 missense probably damaging 0.98
IGL02381:Med23 APN 10 24900728 missense possibly damaging 0.95
IGL02465:Med23 APN 10 24903743 missense probably damaging 0.96
IGL02554:Med23 APN 10 24898575 critical splice donor site probably null
IGL02683:Med23 APN 10 24870717 missense probably benign 0.00
PIT4362001:Med23 UTSW 10 24874571 missense probably benign 0.01
R0080:Med23 UTSW 10 24912817 missense probably benign 0.33
R0125:Med23 UTSW 10 24900788 missense probably damaging 1.00
R0311:Med23 UTSW 10 24897358 missense possibly damaging 0.95
R0765:Med23 UTSW 10 24900710 missense probably damaging 1.00
R1302:Med23 UTSW 10 24888422 unclassified probably null
R1456:Med23 UTSW 10 24903652 splice site probably benign
R1514:Med23 UTSW 10 24892667 splice site probably benign
R1774:Med23 UTSW 10 24903686 missense probably damaging 1.00
R1851:Med23 UTSW 10 24910870 splice site probably null
R1928:Med23 UTSW 10 24909812 missense probably benign
R1975:Med23 UTSW 10 24910766 missense probably benign 0.01
R2011:Med23 UTSW 10 24879755 missense possibly damaging 0.63
R2266:Med23 UTSW 10 24874601 missense probably benign 0.00
R2309:Med23 UTSW 10 24870688 missense probably damaging 0.99
R2507:Med23 UTSW 10 24910813 missense probably damaging 1.00
R2566:Med23 UTSW 10 24888575 missense probably damaging 1.00
R3720:Med23 UTSW 10 24891120 missense probably damaging 1.00
R3771:Med23 UTSW 10 24902201 missense probably damaging 1.00
R3811:Med23 UTSW 10 24892592 nonsense probably null
R3811:Med23 UTSW 10 24892593 splice site probably null
R4305:Med23 UTSW 10 24904270 nonsense probably null
R4323:Med23 UTSW 10 24870705 missense probably benign 0.02
R4701:Med23 UTSW 10 24893648 missense probably damaging 1.00
R4886:Med23 UTSW 10 24874683 critical splice donor site probably null
R4925:Med23 UTSW 10 24910747 missense probably damaging 1.00
R4943:Med23 UTSW 10 24875669 missense possibly damaging 0.92
R5207:Med23 UTSW 10 24895836 nonsense probably null
R5749:Med23 UTSW 10 24888449 missense possibly damaging 0.84
R5896:Med23 UTSW 10 24902145 missense probably damaging 1.00
R5954:Med23 UTSW 10 24870483 splice site probably benign
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6093:Med23 UTSW 10 24878443 missense probably benign 0.16
R6107:Med23 UTSW 10 24906034 nonsense probably null
R6356:Med23 UTSW 10 24888413 missense probably damaging 0.98
R6393:Med23 UTSW 10 24873476 missense possibly damaging 0.91
R6533:Med23 UTSW 10 24893620 missense probably damaging 1.00
R6911:Med23 UTSW 10 24902181 missense probably damaging 0.98
R6981:Med23 UTSW 10 24895824 missense possibly damaging 0.92
R7085:Med23 UTSW 10 24870121 missense probably damaging 1.00
R7215:Med23 UTSW 10 24888429 missense probably benign
R7229:Med23 UTSW 10 24902004 missense probably benign
R7489:Med23 UTSW 10 24904356 missense probably damaging 1.00
R7530:Med23 UTSW 10 24905953 missense probably benign 0.00
R7653:Med23 UTSW 10 24904384 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCTTGACAGCCTATAATCAGATC -3'
(R):5'- TACCCACAGCGCTCACTTTG -3'

Sequencing Primer
(F):5'- TGACAGCCTATAATCAGATCAGTTG -3'
(R):5'- AGGTCTGCCTGACAGCAAC -3'
Posted On2016-12-15