Incidental Mutation 'R5806:Pde8b'
ID448538
Institutional Source Beutler Lab
Gene Symbol Pde8b
Ensembl Gene ENSMUSG00000021684
Gene Namephosphodiesterase 8B
SynonymsB230331L10Rik, C030047E14Rik
MMRRC Submission 043392-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R5806 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location95024454-95250336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95042040 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 524 (K524R)
Ref Sequence ENSEMBL: ENSMUSP00000128987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022192] [ENSMUST00000067082] [ENSMUST00000159608] [ENSMUST00000160957] [ENSMUST00000162153] [ENSMUST00000162292] [ENSMUST00000162412] [ENSMUST00000172104]
Predicted Effect probably damaging
Transcript: ENSMUST00000022192
AA Change: K532R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022192
Gene: ENSMUSG00000021684
AA Change: K532R

DomainStartEndE-ValueType
Pfam:PDE8 1 52 2.2e-39 PFAM
low complexity region 75 98 N/A INTRINSIC
Pfam:Response_reg 134 252 2.9e-15 PFAM
Blast:HDc 420 481 1e-20 BLAST
HDc 565 748 3.01e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000067082
AA Change: K559R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070465
Gene: ENSMUSG00000021684
AA Change: K559R

DomainStartEndE-ValueType
Pfam:PDE8 1 47 1.4e-32 PFAM
low complexity region 75 98 N/A INTRINSIC
Blast:REC 112 235 6e-45 BLAST
PAS 249 316 3.59e-3 SMART
Blast:HDc 447 508 1e-20 BLAST
HDc 592 775 3.01e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159608
AA Change: K532R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125191
Gene: ENSMUSG00000021684
AA Change: K532R

DomainStartEndE-ValueType
Pfam:PDE8 1 52 1.7e-39 PFAM
low complexity region 75 98 N/A INTRINSIC
Pfam:Response_reg 134 252 2.1e-15 PFAM
Blast:HDc 420 481 1e-20 BLAST
HDc 565 666 9.37e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160412
Predicted Effect probably benign
Transcript: ENSMUST00000160957
SMART Domains Protein: ENSMUSP00000125115
Gene: ENSMUSG00000021684

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:Response_reg 30 148 5.7e-16 PFAM
Blast:PAS 165 188 1e-7 BLAST
Blast:HDc 266 327 1e-21 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000162153
AA Change: K474R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124704
Gene: ENSMUSG00000021684
AA Change: K474R

DomainStartEndE-ValueType
Pfam:Response_reg 29 147 2.6e-15 PFAM
PAS 164 231 3.59e-3 SMART
Blast:HDc 362 423 1e-20 BLAST
HDc 507 690 3.01e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162292
AA Change: K482R

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124068
Gene: ENSMUSG00000021684
AA Change: K482R

DomainStartEndE-ValueType
Pfam:PDE8 1 52 2.1e-39 PFAM
low complexity region 75 98 N/A INTRINSIC
Pfam:Response_reg 134 252 2.6e-15 PFAM
Blast:HDc 370 431 1e-20 BLAST
HDc 515 698 3.01e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162412
AA Change: K424R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124409
Gene: ENSMUSG00000021684
AA Change: K424R

DomainStartEndE-ValueType
Pfam:Response_reg 29 147 2.3e-15 PFAM
PAS 164 231 3.59e-3 SMART
Blast:HDc 312 373 1e-20 BLAST
HDc 457 640 3.01e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162882
Predicted Effect probably damaging
Transcript: ENSMUST00000172104
AA Change: K524R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128987
Gene: ENSMUSG00000021684
AA Change: K524R

DomainStartEndE-ValueType
Pfam:PDE8 1 52 2.2e-39 PFAM
low complexity region 75 98 N/A INTRINSIC
Pfam:Response_reg 134 252 2.8e-15 PFAM
PAS 269 336 3.59e-3 SMART
HDc 557 740 3.01e-3 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cyclic nucleotide phosphodiesterase (PDE) that catalyzes the hydrolysis of the second messenger cAMP. The encoded protein, which does not hydrolyze cGMP, is resistant to several PDE inhibitors. Defects in this gene are a cause of autosomal dominant striatal degeneration (ADSD). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased uring corticosterone, decreased serum adrenocorticotropin and decreased sensitivity to a PDE8-selective inhibitor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A G 5: 99,240,872 M216T probably benign Het
Abhd4 A G 14: 54,261,690 N36D probably benign Het
Ankra2 T C 13: 98,268,497 probably null Het
Btd A G 14: 31,667,512 T397A probably benign Het
Ccbe1 T A 18: 66,076,355 K205* probably null Het
Clspn A G 4: 126,586,106 K1081E probably damaging Het
Cmya5 A G 13: 93,093,937 S1548P possibly damaging Het
Coq8b T A 7: 27,250,625 Y376* probably null Het
Cpxm1 C A 2: 130,397,473 A12S probably damaging Het
Cttn T C 7: 144,461,268 T68A probably damaging Het
Cyp2a12 T A 7: 27,029,079 probably null Het
Ddx46 A G 13: 55,663,337 Q582R possibly damaging Het
Ddx55 A G 5: 124,559,199 E208G probably damaging Het
Dync1h1 A T 12: 110,651,653 T3209S probably damaging Het
Dyx1c1 T C 9: 72,962,054 L182P probably benign Het
Ep400 A T 5: 110,755,554 L393* probably null Het
Ern1 G C 11: 106,398,705 S924C probably damaging Het
Fanci T C 7: 79,448,848 I1249T probably damaging Het
Fgfbp3 T G 19: 36,918,549 D223A probably damaging Het
Frmd6 T C 12: 70,890,020 L313P probably damaging Het
Galnt17 A G 5: 130,877,819 Y504H probably damaging Het
Gjb5 A G 4: 127,355,925 I142T probably benign Het
Gvin1 T C 7: 106,158,206 D2352G probably benign Het
H2-M2 G A 17: 37,481,726 T218I probably damaging Het
Hal A G 10: 93,490,984 T161A probably damaging Het
Helb G A 10: 120,092,519 R806C probably damaging Het
Ift80 T A 3: 68,950,476 I279F probably benign Het
Itln1 A T 1: 171,531,152 I149N possibly damaging Het
Kcnt2 A C 1: 140,509,496 T556P probably damaging Het
Klk1b22 A T 7: 44,115,877 E84D possibly damaging Het
Krt78 A G 15: 101,950,502 L305P probably damaging Het
Lzts2 T C 19: 45,026,367 probably benign Het
Macf1 A G 4: 123,371,887 L6843P probably damaging Het
Magi2 C A 5: 20,651,204 H841Q probably benign Het
Mdm1 A T 10: 118,166,658 H628L probably benign Het
Med23 A G 10: 24,907,221 D734G probably damaging Het
Mfsd13a T C 19: 46,366,410 W9R probably benign Het
Mki67 T C 7: 135,704,605 H576R probably damaging Het
Muc5b A G 7: 141,862,835 T3173A possibly damaging Het
Mx1 A T 16: 97,454,151 V234E possibly damaging Het
Myh2 T C 11: 67,181,315 L623P probably damaging Het
Naip1 C T 13: 100,444,735 M1I probably null Het
Ncapd2 A T 6: 125,181,154 V337E probably damaging Het
Nit2 G A 16: 57,161,693 T64M possibly damaging Het
Olfr1195 T C 2: 88,683,151 N194D probably damaging Het
Olfr394 A T 11: 73,887,547 M275K probably damaging Het
Olfr49 A T 14: 54,282,807 F29L probably benign Het
Otub2 A G 12: 103,403,397 E245G probably benign Het
Pih1d2 C T 9: 50,618,450 probably benign Het
Pik3cg T A 12: 32,204,953 D345V possibly damaging Het
Plekhg4 A T 8: 105,378,910 Q669L possibly damaging Het
Prlr A T 15: 10,319,204 Y73F probably damaging Het
Ptk6 T C 2: 181,199,730 I129V possibly damaging Het
Ranbp3 A T 17: 56,710,717 T458S probably benign Het
Ren1 T A 1: 133,355,511 Y128* probably null Het
Rimkla A T 4: 119,468,466 S249T probably damaging Het
Rnf222 T C 11: 68,892,963 S119P possibly damaging Het
Rrbp1 T A 2: 143,963,331 E1007V probably benign Het
Sept11 G A 5: 93,167,578 E389K probably benign Het
Setbp1 A G 18: 78,856,482 probably null Het
Slc25a54 T C 3: 109,080,578 S12P probably benign Het
Slc26a5 A C 5: 21,823,563 F336V probably damaging Het
Slc5a6 T C 5: 31,040,770 T254A probably damaging Het
Smcr8 G T 11: 60,780,382 probably null Het
Srcap A T 7: 127,559,163 probably benign Het
Srrt A T 5: 137,297,917 I509N probably damaging Het
Tcf25 T A 8: 123,381,504 H99Q probably benign Het
Tmem40 A G 6: 115,736,412 V76A probably benign Het
Tnni3k A T 3: 154,827,611 S740T possibly damaging Het
Top3a A G 11: 60,776,920 probably null Het
Tpd52l2 C A 2: 181,502,887 T109K probably damaging Het
Tsnaxip1 C A 8: 105,837,496 D109E possibly damaging Het
Uty G T Y: 1,170,921 D313E probably damaging Het
Zfp143 A T 7: 110,086,235 K423* probably null Het
Zfp407 C T 18: 84,558,614 G1458D probably damaging Het
Other mutations in Pde8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Pde8b APN 13 95034367 missense probably damaging 1.00
IGL01517:Pde8b APN 13 95100887 critical splice donor site probably null
IGL01736:Pde8b APN 13 95030402 missense probably damaging 1.00
IGL01756:Pde8b APN 13 95046387 missense probably damaging 1.00
IGL01867:Pde8b APN 13 95100938 missense probably damaging 0.99
IGL01939:Pde8b APN 13 95095724 missense probably damaging 0.98
IGL02026:Pde8b APN 13 95034361 missense probably damaging 1.00
IGL02685:Pde8b APN 13 95026120 makesense probably null
IGL02830:Pde8b APN 13 95052901 missense probably benign 0.02
IGL02966:Pde8b APN 13 95095648 missense probably damaging 0.96
IGL03003:Pde8b APN 13 95041957 missense probably damaging 1.00
IGL03064:Pde8b APN 13 95046398 missense probably damaging 1.00
IGL03349:Pde8b APN 13 95043043 splice site probably benign
R0356:Pde8b UTSW 13 95046454 missense probably damaging 0.96
R0464:Pde8b UTSW 13 95104698 missense probably damaging 1.00
R0711:Pde8b UTSW 13 95107817 missense possibly damaging 0.87
R1436:Pde8b UTSW 13 95026170 missense probably benign 0.00
R1467:Pde8b UTSW 13 95034172 missense probably damaging 0.99
R1467:Pde8b UTSW 13 95034172 missense probably damaging 0.99
R1494:Pde8b UTSW 13 95047796 missense probably damaging 1.00
R1546:Pde8b UTSW 13 95046443 missense probably damaging 1.00
R1699:Pde8b UTSW 13 95032866 missense probably damaging 1.00
R1795:Pde8b UTSW 13 95042019 missense probably benign 0.10
R1879:Pde8b UTSW 13 95085215 missense possibly damaging 0.95
R2184:Pde8b UTSW 13 95026215 missense probably damaging 1.00
R2223:Pde8b UTSW 13 95043447 missense probably damaging 1.00
R2892:Pde8b UTSW 13 95034259 missense probably damaging 1.00
R3034:Pde8b UTSW 13 95222767 missense probably damaging 1.00
R4204:Pde8b UTSW 13 95222545 missense probably benign 0.22
R4206:Pde8b UTSW 13 95222545 missense probably benign 0.22
R4623:Pde8b UTSW 13 95041939 missense possibly damaging 0.69
R4711:Pde8b UTSW 13 95030450 missense probably benign 0.00
R5133:Pde8b UTSW 13 95086742 missense probably benign 0.05
R5134:Pde8b UTSW 13 95086742 missense probably benign 0.05
R5314:Pde8b UTSW 13 95086853 missense possibly damaging 0.89
R5342:Pde8b UTSW 13 95041990 missense probably damaging 0.99
R5376:Pde8b UTSW 13 95026146 missense probably benign 0.00
R5830:Pde8b UTSW 13 95041890 missense probably benign 0.01
R6021:Pde8b UTSW 13 95026162 missense possibly damaging 0.47
R6035:Pde8b UTSW 13 95027597 intron probably benign
R6035:Pde8b UTSW 13 95027597 intron probably benign
R6129:Pde8b UTSW 13 95041959 missense probably damaging 0.98
R6181:Pde8b UTSW 13 95086808 missense probably benign 0.36
R6313:Pde8b UTSW 13 95042000 nonsense probably null
R6849:Pde8b UTSW 13 95047799 missense possibly damaging 0.89
R6914:Pde8b UTSW 13 95086844 missense probably benign 0.06
R6999:Pde8b UTSW 13 95086834 missense possibly damaging 0.91
R7149:Pde8b UTSW 13 95086841 missense probably benign 0.03
R7275:Pde8b UTSW 13 95042934 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGTTCTTGAATCTCCACCCTAG -3'
(R):5'- CTAGTTGCAAAGTGGGGCTG -3'

Sequencing Primer
(F):5'- CAGCCAGACTGTGATATCTGAAATC -3'
(R):5'- CTGGTTAAGCAGTACCAGTGTTTC -3'
Posted On2016-12-15