Incidental Mutation 'R5807:Ptpn6'
ID448580
Institutional Source Beutler Lab
Gene Symbol Ptpn6
Ensembl Gene ENSMUSG00000004266
Gene Nameprotein tyrosine phosphatase, non-receptor type 6
SynonymsHcph, hcp, SHP-1, Ptp1C
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.601) question?
Stock #R5807 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location124720707-124738714 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124724984 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 447 (H447R)
Ref Sequence ENSEMBL: ENSMUSP00000133991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004377] [ENSMUST00000112484] [ENSMUST00000171549] [ENSMUST00000174265] [ENSMUST00000174787]
Predicted Effect probably benign
Transcript: ENSMUST00000004377
AA Change: H447R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000004377
Gene: ENSMUSG00000004266
AA Change: H447R

DomainStartEndE-ValueType
SH2 4 87 1.43e-28 SMART
SH2 110 202 1.45e-29 SMART
PTPc 245 519 7.51e-131 SMART
low complexity region 571 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112484
AA Change: H445R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108103
Gene: ENSMUSG00000004266
AA Change: H445R

DomainStartEndE-ValueType
SH2 2 85 4.05e-28 SMART
SH2 108 200 1.45e-29 SMART
PTPc 243 517 7.51e-131 SMART
low complexity region 569 579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171549
AA Change: H447R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129124
Gene: ENSMUSG00000004266
AA Change: H447R

DomainStartEndE-ValueType
SH2 4 87 1.43e-28 SMART
SH2 110 202 1.45e-29 SMART
PTPc 245 519 7.51e-131 SMART
low complexity region 571 581 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172613
Predicted Effect probably benign
Transcript: ENSMUST00000172690
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173228
Predicted Effect probably benign
Transcript: ENSMUST00000173315
Predicted Effect probably benign
Transcript: ENSMUST00000174265
AA Change: H406R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133991
Gene: ENSMUSG00000004266
AA Change: H406R

DomainStartEndE-ValueType
Pfam:SH2 1 40 3.5e-6 PFAM
SH2 69 161 1.45e-29 SMART
PTPc 204 478 7.51e-131 SMART
low complexity region 530 540 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174787
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. N-terminal part of this PTP contains two tandem Src homolog (SH2) domains, which act as protein phospho-tyrosine binding domains, and mediate the interaction of this PTP with its substrates. This PTP is expressed primarily in hematopoietic cells, and functions as an important regulator of multiple signaling pathways in hematopoietic cells. This PTP has been shown to interact with, and dephosphorylate a wide spectrum of phospho-proteins involved in hematopoietic cell signaling. Multiple alternatively spliced variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants are immunodeficient and autoimmune and exhibit neutrophilic skin lesions that disrupt hair follicles and give the motheaten appearance. Alleles vary in severity, with death occurring at 6-9 weeks postnatally due to severe pneumonitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,303,492 L943P probably damaging Het
Abcg5 C A 17: 84,672,291 V214F probably damaging Het
Ang T A 14: 51,101,429 F9Y probably benign Het
Arfgef3 A G 10: 18,647,798 probably null Het
Arhgef4 A G 1: 34,807,615 probably benign Het
Atp11b T C 3: 35,812,279 I609T probably damaging Het
Atp5b G A 10: 128,088,562 probably benign Het
Atp9a G A 2: 168,653,534 A660V probably damaging Het
Avpr1a A G 10: 122,449,471 T223A probably benign Het
Bmp2k T C 5: 97,063,494 M507T unknown Het
Cep295 A G 9: 15,332,532 S287P probably damaging Het
Chrna7 T A 7: 63,148,601 D111V probably damaging Het
Cnr2 A G 4: 135,917,436 D275G probably benign Het
Col28a1 T A 6: 8,158,144 M305L probably benign Het
Cpb1 T A 3: 20,263,742 D206V probably damaging Het
Cyp2c50 T C 19: 40,113,500 L453S probably damaging Het
Ddx52 T G 11: 83,949,682 S284A probably benign Het
Efcab1 A T 16: 14,916,972 I69F probably benign Het
Eif2ak4 G T 2: 118,388,851 R48L probably benign Het
Esrrb A G 12: 86,514,401 E324G possibly damaging Het
Fbxo21 A G 5: 117,976,868 E23G probably benign Het
Fcamr T C 1: 130,811,526 S188P probably damaging Het
Fer1l6 C A 15: 58,590,550 S818* probably null Het
Fn1 T C 1: 71,648,059 D213G probably damaging Het
Gcg A G 2: 62,475,725 I176T possibly damaging Het
Glis1 T A 4: 107,568,082 S297T probably benign Het
Gm266 T C 12: 111,485,739 D11G probably benign Het
Gm5070 C A 3: 95,410,654 C185F noncoding transcript Het
Gm8444 T C 15: 81,843,453 T83A probably benign Het
Gm8989 T A 7: 106,330,223 noncoding transcript Het
Golga4 A G 9: 118,527,130 T117A probably damaging Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Herc2 T A 7: 56,230,919 F4766L probably damaging Het
Inhbc C A 10: 127,357,542 E202* probably null Het
Kcnu1 C T 8: 25,849,714 T20I possibly damaging Het
Klhdc3 T C 17: 46,677,465 D161G probably damaging Het
Krt84 T A 15: 101,530,212 K280M probably damaging Het
Krtap9-5 T A 11: 99,949,069 C199S unknown Het
Mrgprb3 A G 7: 48,643,362 V147A probably benign Het
Ndufs6 A T 13: 73,327,434 F48L probably damaging Het
Obscn T C 11: 59,079,650 S2586G probably damaging Het
Olfr148 A G 9: 39,614,463 R299G probably benign Het
Olfr156 C A 4: 43,820,912 V150L probably benign Het
Olfr559 C T 7: 102,724,202 R96H possibly damaging Het
Osbpl6 A G 2: 76,584,513 D562G probably damaging Het
Pdilt A G 7: 119,500,543 probably benign Het
Phf12 C A 11: 78,022,426 D401E probably benign Het
Pla2r1 C T 2: 60,428,721 V1108M possibly damaging Het
Prim2 A G 1: 33,480,406 probably benign Het
Qpctl G T 7: 19,143,207 H329N probably damaging Het
Ripk3 T A 14: 55,785,298 N454Y probably damaging Het
Rnase1 A G 14: 51,145,450 V149A probably benign Het
Rtn3 T A 19: 7,456,827 D600V probably damaging Het
Slamf1 A G 1: 171,775,062 Y119C probably damaging Het
Slc25a34 A G 4: 141,623,662 M12T probably benign Het
Tmem38a A G 8: 72,580,100 Y141C probably damaging Het
Tnr C T 1: 159,886,930 T793I possibly damaging Het
Tns3 T C 11: 8,493,211 D384G probably damaging Het
Vmn2r116 T A 17: 23,387,307 Y398N probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Other mutations in Ptpn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00710:Ptpn6 APN 6 124732356 unclassified probably null
IGL01490:Ptpn6 APN 6 124728344 missense probably damaging 1.00
IGL01865:Ptpn6 APN 6 124732465 missense probably damaging 1.00
IGL02017:Ptpn6 APN 6 124732486 missense probably damaging 0.98
IGL02272:Ptpn6 APN 6 124721208 missense probably damaging 0.99
IGL02276:Ptpn6 APN 6 124728865 missense probably null 1.00
IGL02556:Ptpn6 APN 6 124728660 missense probably benign 0.00
candle UTSW 6 124728419 missense probably damaging 1.00
farfalla_notturna UTSW 6 124732435 missense probably damaging 1.00
spin UTSW 6 124728559 missense probably damaging 0.99
spin2 UTSW 6 124732369 missense probably damaging 1.00
Vermeil UTSW 6 124732950 missense probably benign 0.10
R0183:Ptpn6 UTSW 6 124728951 missense probably damaging 1.00
R0254:Ptpn6 UTSW 6 124728150 missense probably damaging 1.00
R0636:Ptpn6 UTSW 6 124725279 missense probably benign
R0835:Ptpn6 UTSW 6 124727536 critical splice acceptor site probably null
R1383:Ptpn6 UTSW 6 124721893 missense probably damaging 1.00
R1638:Ptpn6 UTSW 6 124721185 missense probably benign
R1900:Ptpn6 UTSW 6 124728933 missense probably benign 0.15
R2047:Ptpn6 UTSW 6 124721789 missense probably benign 0.42
R2143:Ptpn6 UTSW 6 124724984 missense probably benign 0.01
R3907:Ptpn6 UTSW 6 124725276 missense possibly damaging 0.86
R4082:Ptpn6 UTSW 6 124728419 missense probably damaging 1.00
R4382:Ptpn6 UTSW 6 124727398 missense possibly damaging 0.86
R5319:Ptpn6 UTSW 6 124732950 missense probably benign 0.10
R5878:Ptpn6 UTSW 6 124728785 missense probably damaging 1.00
R6056:Ptpn6 UTSW 6 124732435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTCAGCATCGTTCCTCAAC -3'
(R):5'- TTGTGTGGAAGCAGCAGAC -3'

Sequencing Primer
(F):5'- TGTTAGTACGCCATGAGCAC -3'
(R):5'- GGAAGCAGCAGACATTACCTCTTTG -3'
Posted OnDec 15, 2016