Incidental Mutation 'R5807:Gm266'
ID448605
Institutional Source Beutler Lab
Gene Symbol Gm266
Ensembl Gene ENSMUSG00000010529
Gene Namepredicted gene 266
SynonymsLOC212539
MMRRC Submission 043393-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R5807 (G1)
Quality Score218
Status Validated
Chromosome12
Chromosomal Location111484609-111485823 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111485739 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 11 (D11G)
Ref Sequence ENSEMBL: ENSMUSP00000010673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010673]
Predicted Effect probably benign
Transcript: ENSMUST00000010673
AA Change: D11G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000010673
Gene: ENSMUSG00000010529
AA Change: D11G

DomainStartEndE-ValueType
RAS 9 175 2.93e-53 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221429
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,303,492 L943P probably damaging Het
Abcg5 C A 17: 84,672,291 V214F probably damaging Het
Ang T A 14: 51,101,429 probably benign Het
Arfgef3 A G 10: 18,647,798 probably null Het
Arhgef4 A G 1: 34,807,615 probably benign Het
Atp11b T C 3: 35,812,279 I409T probably damaging Het
Atp5b G A 10: 128,088,562 probably benign Het
Atp9a G A 2: 168,653,534 A660V probably damaging Het
Avpr1a A G 10: 122,449,471 T223A probably benign Het
Bmp2k T C 5: 97,063,494 M507T unknown Het
Cep295 A G 9: 15,332,532 S287P probably damaging Het
Chrna7 T A 7: 63,148,601 D111V probably damaging Het
Cnr2 A G 4: 135,917,436 D275G probably benign Het
Col28a1 T A 6: 8,158,144 M305L probably benign Het
Cpb1 T A 3: 20,263,742 D206V probably damaging Het
Cyp2c50 T C 19: 40,113,500 L453S probably damaging Het
Ddx52 T G 11: 83,949,682 S284A probably benign Het
Efcab1 A T 16: 14,916,972 I69F probably benign Het
Eif2ak4 G T 2: 118,388,851 R48L probably benign Het
Esrrb A G 12: 86,514,401 E303G possibly damaging Het
Fbxo21 A G 5: 117,976,868 E23G probably benign Het
Fcamr T C 1: 130,811,526 S188P probably damaging Het
Fer1l6 C A 15: 58,590,550 S818* probably null Het
Fn1 T C 1: 71,648,059 D213G probably damaging Het
Gcg A G 2: 62,475,725 I176T possibly damaging Het
Glis1 T A 4: 107,568,082 S109T probably benign Het
Gm5070 C A 3: 95,410,654 noncoding transcript Het
Gm8444 T C 15: 81,843,453 probably benign Het
Gm8989 T A 7: 106,330,223 noncoding transcript Het
Golga4 A G 9: 118,527,130 T117A probably damaging Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Herc2 T A 7: 56,230,919 F4766L probably damaging Het
Inhbc C A 10: 127,357,542 E202* probably null Het
Kcnu1 C T 8: 25,849,714 T20I possibly damaging Het
Klhdc3 T C 17: 46,677,465 D161G probably damaging Het
Krt84 T A 15: 101,530,212 K280M probably damaging Het
Krtap9-5 T A 11: 99,949,069 C199S unknown Het
Mrgprb3 A G 7: 48,643,362 V147A probably benign Het
Ndufs6 A T 13: 73,327,434 F48L probably damaging Het
Obscn T C 11: 59,079,650 S2586G probably damaging Het
Olfr148 A G 9: 39,614,463 R299G probably benign Het
Olfr156 C A 4: 43,820,912 V150L probably benign Het
Olfr559 C T 7: 102,724,202 R96H possibly damaging Het
Osbpl6 A G 2: 76,584,513 D416G probably damaging Het
Pdilt A G 7: 119,500,543 probably benign Het
Phf12 C A 11: 78,022,426 D401E probably benign Het
Pla2r1 C T 2: 60,428,721 V1108M possibly damaging Het
Prim2 A G 1: 33,480,406 probably benign Het
Ptpn6 T C 6: 124,724,984 H406R probably benign Het
Qpctl G T 7: 19,143,207 H329N probably damaging Het
Ripk3 T A 14: 55,785,298 N390Y probably damaging Het
Rnase1 A G 14: 51,145,450 V149A probably benign Het
Rtn3 T A 19: 7,456,827 D581V probably damaging Het
Slamf1 A G 1: 171,775,062 Y119C probably damaging Het
Slc25a34 A G 4: 141,623,662 M12T probably benign Het
Tmem38a A G 8: 72,580,100 Y141C probably damaging Het
Tnr C T 1: 159,886,930 T793I possibly damaging Het
Tns3 T C 11: 8,493,211 D384G probably damaging Het
Vmn2r116 T A 17: 23,387,307 Y398N probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Other mutations in Gm266
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1659:Gm266 UTSW 12 111485289 missense probably damaging 0.98
R1727:Gm266 UTSW 12 111485479 missense possibly damaging 0.95
R2040:Gm266 UTSW 12 111485698 missense possibly damaging 0.71
R2114:Gm266 UTSW 12 111485682 missense possibly damaging 0.71
R2142:Gm266 UTSW 12 111485181 missense possibly damaging 0.70
Z1088:Gm266 UTSW 12 111485172 missense probably damaging 1.00
Z1088:Gm266 UTSW 12 111485337 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCGCTGTTCCTGATGTACAG -3'
(R):5'- ATAGCCAGCTCAGGACTGACTG -3'

Sequencing Primer
(F):5'- TGACCAGATGCTCGGCG -3'
(R):5'- TCGGCTAGGCGAAGAGACTC -3'
Posted On2016-12-15