Incidental Mutation 'R5635:Kalrn'
ID 448684
Institutional Source Beutler Lab
Gene Symbol Kalrn
Ensembl Gene ENSMUSG00000061751
Gene Name kalirin, RhoGEF kinase
Synonyms E530005C20Rik, LOC224126, Hapip, 2210407G14Rik
MMRRC Submission 043286-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.920) question?
Stock # R5635 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 33789443-34393647 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 33834454 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 627 (N627I)
Ref Sequence ENSEMBL: ENSMUSP00000156147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000114963] [ENSMUST00000114964] [ENSMUST00000114966] [ENSMUST00000114973] [ENSMUST00000232157]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000076810
AA Change: N2328I

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751
AA Change: N2328I

DomainStartEndE-ValueType
SEC14 20 159 2.22e-30 SMART
SPEC 173 289 5.32e-9 SMART
SPEC 295 397 1.19e-11 SMART
SPEC 400 515 1.83e0 SMART
SPEC 521 623 9.84e-13 SMART
SPEC 626 748 2.74e-2 SMART
SPEC 875 976 8.11e-14 SMART
SPEC 1106 1208 4.7e-10 SMART
RhoGEF 1258 1428 3.6e-56 SMART
PH 1442 1555 5.24e-8 SMART
SH3 1622 1683 1.23e-7 SMART
RhoGEF 1904 2074 1.47e-52 SMART
PH 2094 2199 9.87e-4 SMART
SH3 2295 2356 2.78e-2 SMART
IGc2 2455 2527 4.28e-12 SMART
FN3 2541 2623 3.07e-11 SMART
S_TKc 2656 2910 1.28e-71 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114963
AA Change: N697I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110614
Gene: ENSMUSG00000061751
AA Change: N697I

DomainStartEndE-ValueType
SH3 22 83 1.23e-7 SMART
RhoGEF 273 443 1.47e-52 SMART
PH 463 568 9.87e-4 SMART
SH3 664 725 2.78e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114964
AA Change: N628I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110615
Gene: ENSMUSG00000061751
AA Change: N628I

DomainStartEndE-ValueType
RhoGEF 204 374 1.47e-52 SMART
PH 394 499 9.87e-4 SMART
SH3 595 656 2.78e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114966
AA Change: N659I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110617
Gene: ENSMUSG00000061751
AA Change: N659I

DomainStartEndE-ValueType
RhoGEF 235 405 1.47e-52 SMART
PH 425 530 9.87e-4 SMART
SH3 626 687 2.78e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114973
AA Change: N659I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110624
Gene: ENSMUSG00000061751
AA Change: N659I

DomainStartEndE-ValueType
RhoGEF 235 405 1.47e-52 SMART
PH 425 530 9.87e-4 SMART
SH3 626 687 2.78e-2 SMART
IGc2 786 858 4.28e-12 SMART
FN3 872 954 3.07e-11 SMART
S_TKc 987 1241 1.28e-71 SMART
Predicted Effect unknown
Transcript: ENSMUST00000142817
AA Change: N2323I
SMART Domains Protein: ENSMUSP00000116188
Gene: ENSMUSG00000061751
AA Change: N2323I

DomainStartEndE-ValueType
SEC14 16 155 2.22e-30 SMART
SPEC 169 285 5.32e-9 SMART
SPEC 291 393 1.19e-11 SMART
SPEC 396 511 1.83e0 SMART
SPEC 517 619 9.84e-13 SMART
SPEC 622 744 2.74e-2 SMART
SPEC 871 972 8.11e-14 SMART
SPEC 1102 1204 4.7e-10 SMART
RhoGEF 1254 1424 3.6e-56 SMART
PH 1438 1551 5.24e-8 SMART
SH3 1618 1679 1.23e-7 SMART
RhoGEF 1900 2070 1.47e-52 SMART
PH 2090 2195 9.87e-4 SMART
SH3 2291 2352 2.78e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000232157
AA Change: N627I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231657
Meta Mutation Damage Score 0.1642 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,094,273 (GRCm39) M53K possibly damaging Het
Aldh3b3 C T 19: 4,018,512 (GRCm39) T409I probably benign Het
Ankrd13a C A 5: 114,939,778 (GRCm39) H468Q possibly damaging Het
Ap2a1 A C 7: 44,573,325 (GRCm39) probably benign Het
Arfgef1 A T 1: 10,259,085 (GRCm39) S671T possibly damaging Het
C1ra G A 6: 124,493,683 (GRCm39) C145Y probably damaging Het
Catsperd G A 17: 56,939,335 (GRCm39) V55M possibly damaging Het
Ccdc30 T C 4: 119,216,871 (GRCm39) N123D possibly damaging Het
Cdc20 A T 4: 118,293,224 (GRCm39) V232E possibly damaging Het
Cfap251 A T 5: 123,460,635 (GRCm39) Q225L probably benign Het
Cfap58 T A 19: 47,971,981 (GRCm39) V637E possibly damaging Het
Coq4 T A 2: 29,678,367 (GRCm39) V24E possibly damaging Het
Crim1 T A 17: 78,623,070 (GRCm39) F423I probably damaging Het
Crls1 T C 2: 132,706,062 (GRCm39) V262A possibly damaging Het
Crybb1 T C 5: 112,405,425 (GRCm39) probably null Het
Cutc T A 19: 43,744,069 (GRCm39) N23K probably benign Het
Cxcl10 T A 5: 92,495,698 (GRCm39) I82F probably damaging Het
Cyp3a44 A T 5: 145,738,124 (GRCm39) F60L possibly damaging Het
Dhx9 A G 1: 153,359,493 (GRCm39) M35T probably benign Het
Dnah8 A G 17: 30,925,360 (GRCm39) E1265G probably benign Het
Dzank1 C G 2: 144,325,327 (GRCm39) D548H probably damaging Het
Eef2kmt A G 16: 5,066,893 (GRCm39) V120A probably damaging Het
Elp4 A G 2: 105,644,609 (GRCm39) probably null Het
Etl4 A T 2: 20,811,846 (GRCm39) I1310F probably damaging Het
Exoc6b A T 6: 84,828,909 (GRCm39) F492I probably damaging Het
F2rl2 A T 13: 95,837,290 (GRCm39) I112F possibly damaging Het
Farp1 T A 14: 121,513,716 (GRCm39) I837N possibly damaging Het
Fars2 A G 13: 36,594,129 (GRCm39) E378G probably damaging Het
Fgg A G 3: 82,918,730 (GRCm39) T248A probably benign Het
Flrt3 T A 2: 140,502,420 (GRCm39) T403S probably damaging Het
Fndc3b C T 3: 27,596,080 (GRCm39) E170K probably damaging Het
Gm17728 A G 17: 9,641,202 (GRCm39) H104R probably benign Het
H2ac21 C A 3: 96,127,593 (GRCm39) T121K possibly damaging Het
Hivep1 A G 13: 42,313,603 (GRCm39) T1948A probably benign Het
Hspa4l T A 3: 40,700,177 (GRCm39) I23N probably damaging Het
Ighv1-75 A G 12: 115,797,829 (GRCm39) V31A probably benign Het
Lrp1b T G 2: 42,542,834 (GRCm39) probably benign Het
Lrrc36 G A 8: 106,184,205 (GRCm39) V480M probably damaging Het
Map4k3 A T 17: 80,920,924 (GRCm39) N534K possibly damaging Het
Mybpc3 C T 2: 90,965,174 (GRCm39) T1081I probably benign Het
Nfrkb T C 9: 31,310,594 (GRCm39) S351P probably damaging Het
Nme4 A T 17: 26,313,205 (GRCm39) V43E probably damaging Het
Notch1 C T 2: 26,366,173 (GRCm39) E794K probably damaging Het
Nufip1 A T 14: 76,363,586 (GRCm39) K270M probably damaging Het
Or10ak16 G T 4: 118,750,832 (GRCm39) G184V probably benign Het
Or1e30 G T 11: 73,678,460 (GRCm39) R232L probably benign Het
Or51b6 G A 7: 103,555,845 (GRCm39) M66I probably benign Het
Or5t5 A G 2: 86,616,070 (GRCm39) probably null Het
Or8g51 A G 9: 38,609,455 (GRCm39) I73T possibly damaging Het
Pcdhb15 T A 18: 37,606,823 (GRCm39) Y18* probably null Het
Pcdhb21 A T 18: 37,646,970 (GRCm39) Y33F probably benign Het
Pds5b T A 5: 150,701,686 (GRCm39) H772Q possibly damaging Het
Pik3r4 C A 9: 105,545,024 (GRCm39) H168N probably benign Het
Pitpnm3 A G 11: 71,957,986 (GRCm39) S386P possibly damaging Het
Plg A G 17: 12,614,641 (GRCm39) H307R probably damaging Het
Prdm9 A C 17: 15,782,702 (GRCm39) D96E probably damaging Het
Prmt8 A G 6: 127,745,692 (GRCm39) S7P probably damaging Het
Prune2 T C 19: 17,095,573 (GRCm39) V359A probably benign Het
Pxn A T 5: 115,689,551 (GRCm39) Q279L probably benign Het
Rarb A T 14: 16,443,788 (GRCm38) C167S probably damaging Het
Rps6kb2 T A 19: 4,211,133 (GRCm39) I131F probably damaging Het
Sec14l3 T A 11: 4,021,484 (GRCm39) V219E probably damaging Het
Simc1 A G 13: 54,673,217 (GRCm39) T522A probably benign Het
Slc1a6 T C 10: 78,624,925 (GRCm39) V110A possibly damaging Het
Slc38a11 T G 2: 65,191,747 (GRCm39) probably null Het
Snx13 T A 12: 35,190,170 (GRCm39) D840E probably benign Het
Sp100 C A 1: 85,609,985 (GRCm39) probably benign Het
Spc24 G T 9: 21,668,686 (GRCm39) L104I probably damaging Het
Surf4 T C 2: 26,823,325 (GRCm39) N4D probably benign Het
Tas2r131 A T 6: 132,934,571 (GRCm39) D79E probably benign Het
Tbc1d20 T C 2: 152,153,381 (GRCm39) S304P probably benign Het
Tbrg1 T C 9: 37,566,287 (GRCm39) probably benign Het
Tmem214 A G 5: 31,028,861 (GRCm39) N150S probably damaging Het
Trappc13 A T 13: 104,286,606 (GRCm39) I217K probably benign Het
Ttc41 T A 10: 86,572,841 (GRCm39) C738S probably benign Het
Ttn T C 2: 76,540,068 (GRCm39) Q25979R probably benign Het
Tubb2b A T 13: 34,312,180 (GRCm39) N204K probably damaging Het
Ube3a T A 7: 58,938,236 (GRCm39) M713K probably damaging Het
Usp37 T C 1: 74,534,970 (GRCm39) probably benign Het
Vegfb T A 19: 6,960,214 (GRCm39) *189C probably null Het
Vmn2r82 A G 10: 79,214,652 (GRCm39) N212D probably benign Het
Vta1 A T 10: 14,543,866 (GRCm39) probably null Het
Xdh T G 17: 74,220,870 (GRCm39) I620L possibly damaging Het
Xpnpep3 A G 15: 81,320,970 (GRCm39) Y283C probably benign Het
Zscan18 A G 7: 12,504,791 (GRCm39) S609P probably benign Het
Other mutations in Kalrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Kalrn APN 16 33,996,092 (GRCm39) splice site probably benign
IGL01364:Kalrn APN 16 34,082,999 (GRCm39) missense probably damaging 1.00
IGL01510:Kalrn APN 16 34,055,700 (GRCm39) missense possibly damaging 0.52
IGL01664:Kalrn APN 16 34,114,531 (GRCm39) missense probably damaging 1.00
IGL01934:Kalrn APN 16 34,018,882 (GRCm39) splice site probably null
IGL02059:Kalrn APN 16 34,072,711 (GRCm39) missense possibly damaging 0.95
IGL02102:Kalrn APN 16 34,040,592 (GRCm39) missense probably damaging 1.00
IGL02306:Kalrn APN 16 34,130,897 (GRCm39) missense probably damaging 0.97
IGL02328:Kalrn APN 16 34,152,594 (GRCm39) missense probably damaging 0.98
IGL02532:Kalrn APN 16 34,181,216 (GRCm39) missense probably damaging 1.00
IGL02685:Kalrn APN 16 34,334,329 (GRCm39) nonsense probably null
IGL02696:Kalrn APN 16 34,040,484 (GRCm39) missense probably damaging 1.00
IGL02708:Kalrn APN 16 34,212,420 (GRCm39) missense probably damaging 1.00
IGL02937:Kalrn APN 16 34,040,500 (GRCm39) nonsense probably null
IGL03188:Kalrn APN 16 34,134,562 (GRCm39) missense probably benign 0.01
IGL03289:Kalrn APN 16 34,205,667 (GRCm39) missense possibly damaging 0.90
IGL03408:Kalrn APN 16 34,134,546 (GRCm39) missense probably damaging 0.99
breeze UTSW 16 33,834,045 (GRCm39) missense
ethereal UTSW 16 33,795,805 (GRCm39) utr 3 prime probably benign
Feather UTSW 16 34,134,579 (GRCm39) missense probably damaging 0.99
Hidden UTSW 16 33,848,346 (GRCm39) missense probably damaging 1.00
Soulful UTSW 16 34,007,854 (GRCm39) nonsense probably null
G1Funyon:Kalrn UTSW 16 34,177,470 (GRCm39) missense probably benign 0.05
PIT4498001:Kalrn UTSW 16 33,851,952 (GRCm39) missense possibly damaging 0.81
R0019:Kalrn UTSW 16 34,018,884 (GRCm39) splice site probably benign
R0043:Kalrn UTSW 16 33,875,276 (GRCm39) missense probably damaging 1.00
R0052:Kalrn UTSW 16 34,177,541 (GRCm39) missense probably damaging 1.00
R0066:Kalrn UTSW 16 34,024,327 (GRCm39) missense probably damaging 1.00
R0098:Kalrn UTSW 16 33,795,989 (GRCm39) missense possibly damaging 0.89
R0098:Kalrn UTSW 16 33,795,989 (GRCm39) missense possibly damaging 0.89
R0111:Kalrn UTSW 16 33,851,960 (GRCm39) missense probably damaging 1.00
R0113:Kalrn UTSW 16 33,870,306 (GRCm39) intron probably benign
R0183:Kalrn UTSW 16 33,991,749 (GRCm39) splice site probably null
R0422:Kalrn UTSW 16 34,134,643 (GRCm39) missense probably damaging 0.99
R0498:Kalrn UTSW 16 33,875,261 (GRCm39) missense possibly damaging 0.61
R0614:Kalrn UTSW 16 33,814,040 (GRCm39) splice site probably benign
R0656:Kalrn UTSW 16 33,852,837 (GRCm39) missense probably damaging 1.00
R0671:Kalrn UTSW 16 33,936,778 (GRCm39) missense probably benign 0.04
R0707:Kalrn UTSW 16 33,830,951 (GRCm39) missense possibly damaging 0.88
R0709:Kalrn UTSW 16 33,855,924 (GRCm39) missense probably damaging 1.00
R0834:Kalrn UTSW 16 33,870,289 (GRCm39) missense possibly damaging 0.94
R0976:Kalrn UTSW 16 34,205,760 (GRCm39) missense probably damaging 1.00
R1297:Kalrn UTSW 16 33,836,868 (GRCm39) missense probably damaging 0.99
R1355:Kalrn UTSW 16 33,795,954 (GRCm39) missense possibly damaging 0.74
R1370:Kalrn UTSW 16 33,795,954 (GRCm39) missense possibly damaging 0.74
R1389:Kalrn UTSW 16 33,809,173 (GRCm39) missense probably benign 0.01
R1398:Kalrn UTSW 16 34,033,190 (GRCm39) missense probably damaging 1.00
R1427:Kalrn UTSW 16 33,796,124 (GRCm39) missense probably damaging 1.00
R1458:Kalrn UTSW 16 33,994,857 (GRCm39) missense probably damaging 1.00
R1470:Kalrn UTSW 16 34,007,841 (GRCm39) missense probably damaging 1.00
R1470:Kalrn UTSW 16 34,007,841 (GRCm39) missense probably damaging 1.00
R1557:Kalrn UTSW 16 34,134,648 (GRCm39) missense possibly damaging 0.92
R1559:Kalrn UTSW 16 33,830,918 (GRCm39) missense possibly damaging 0.92
R1654:Kalrn UTSW 16 33,796,108 (GRCm39) missense probably damaging 1.00
R1703:Kalrn UTSW 16 34,025,696 (GRCm39) missense probably damaging 1.00
R1759:Kalrn UTSW 16 34,181,320 (GRCm39) missense probably damaging 0.97
R1764:Kalrn UTSW 16 34,033,243 (GRCm39) missense probably damaging 1.00
R1824:Kalrn UTSW 16 34,114,585 (GRCm39) missense probably damaging 1.00
R1845:Kalrn UTSW 16 34,177,331 (GRCm39) missense probably damaging 0.99
R1850:Kalrn UTSW 16 33,796,293 (GRCm39) missense probably damaging 0.98
R1921:Kalrn UTSW 16 34,212,463 (GRCm39) missense probably benign 0.02
R1922:Kalrn UTSW 16 34,212,463 (GRCm39) missense probably benign 0.02
R1970:Kalrn UTSW 16 33,797,894 (GRCm39) critical splice donor site probably null
R1991:Kalrn UTSW 16 33,796,108 (GRCm39) missense probably damaging 1.00
R1992:Kalrn UTSW 16 33,796,108 (GRCm39) missense probably damaging 1.00
R2001:Kalrn UTSW 16 33,848,415 (GRCm39) missense probably damaging 1.00
R2025:Kalrn UTSW 16 34,010,106 (GRCm39) missense probably damaging 0.96
R2048:Kalrn UTSW 16 34,072,680 (GRCm39) missense probably benign 0.18
R2076:Kalrn UTSW 16 34,152,513 (GRCm39) missense probably benign 0.15
R2118:Kalrn UTSW 16 34,152,600 (GRCm39) missense possibly damaging 0.84
R2136:Kalrn UTSW 16 34,128,094 (GRCm39) missense possibly damaging 0.82
R2145:Kalrn UTSW 16 33,829,632 (GRCm39) unclassified probably benign
R2193:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2195:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2234:Kalrn UTSW 16 33,996,632 (GRCm39) splice site probably null
R2404:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2405:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2408:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2411:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2570:Kalrn UTSW 16 34,130,865 (GRCm39) missense probably damaging 1.00
R2903:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2904:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2924:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R3411:Kalrn UTSW 16 34,032,642 (GRCm39) missense probably benign 0.07
R3693:Kalrn UTSW 16 34,177,685 (GRCm39) missense probably damaging 1.00
R3709:Kalrn UTSW 16 34,212,400 (GRCm39) splice site probably null
R3788:Kalrn UTSW 16 34,040,610 (GRCm39) missense probably damaging 1.00
R3833:Kalrn UTSW 16 33,860,259 (GRCm39) nonsense probably null
R3871:Kalrn UTSW 16 34,024,226 (GRCm39) splice site probably null
R3934:Kalrn UTSW 16 34,130,901 (GRCm39) missense probably benign 0.34
R4033:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4056:Kalrn UTSW 16 34,134,579 (GRCm39) missense probably damaging 0.99
R4057:Kalrn UTSW 16 34,134,579 (GRCm39) missense probably damaging 0.99
R4303:Kalrn UTSW 16 34,055,761 (GRCm39) missense probably damaging 1.00
R4402:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4444:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4482:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4487:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4558:Kalrn UTSW 16 33,807,578 (GRCm39) missense possibly damaging 0.46
R4572:Kalrn UTSW 16 34,212,412 (GRCm39) missense probably damaging 0.98
R4583:Kalrn UTSW 16 34,055,637 (GRCm39) missense probably damaging 1.00
R4604:Kalrn UTSW 16 34,334,296 (GRCm39) missense possibly damaging 0.46
R4620:Kalrn UTSW 16 33,849,075 (GRCm39) missense probably damaging 0.99
R4651:Kalrn UTSW 16 33,996,761 (GRCm39) missense probably damaging 1.00
R4703:Kalrn UTSW 16 34,024,327 (GRCm39) missense probably damaging 1.00
R4704:Kalrn UTSW 16 34,024,327 (GRCm39) missense probably damaging 1.00
R4705:Kalrn UTSW 16 34,024,327 (GRCm39) missense probably damaging 1.00
R4760:Kalrn UTSW 16 34,018,857 (GRCm39) missense probably damaging 1.00
R4793:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4794:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4811:Kalrn UTSW 16 34,177,339 (GRCm39) missense probably damaging 1.00
R4816:Kalrn UTSW 16 34,334,389 (GRCm39) unclassified probably benign
R4888:Kalrn UTSW 16 33,991,700 (GRCm39) missense probably damaging 1.00
R4952:Kalrn UTSW 16 34,177,785 (GRCm39) splice site probably null
R5030:Kalrn UTSW 16 33,796,112 (GRCm39) missense probably benign 0.00
R5045:Kalrn UTSW 16 34,134,722 (GRCm39) nonsense probably null
R5117:Kalrn UTSW 16 33,853,971 (GRCm39) critical splice acceptor site probably null
R5289:Kalrn UTSW 16 34,072,711 (GRCm39) missense possibly damaging 0.95
R5426:Kalrn UTSW 16 34,083,023 (GRCm39) missense probably damaging 1.00
R5432:Kalrn UTSW 16 33,873,992 (GRCm39) missense probably damaging 1.00
R5611:Kalrn UTSW 16 33,996,150 (GRCm39) missense probably damaging 1.00
R5629:Kalrn UTSW 16 33,860,304 (GRCm39) missense possibly damaging 0.77
R5713:Kalrn UTSW 16 33,836,949 (GRCm39) missense probably benign
R5716:Kalrn UTSW 16 33,807,546 (GRCm39) missense probably benign 0.01
R5772:Kalrn UTSW 16 33,796,190 (GRCm39) missense probably damaging 1.00
R5797:Kalrn UTSW 16 34,032,619 (GRCm39) missense probably damaging 0.98
R5835:Kalrn UTSW 16 33,807,461 (GRCm39) missense probably benign 0.28
R5895:Kalrn UTSW 16 33,795,805 (GRCm39) utr 3 prime probably benign
R5924:Kalrn UTSW 16 34,064,203 (GRCm39) missense probably damaging 1.00
R5999:Kalrn UTSW 16 34,177,713 (GRCm39) missense probably damaging 1.00
R6010:Kalrn UTSW 16 33,830,950 (GRCm39) missense probably benign 0.06
R6052:Kalrn UTSW 16 34,181,255 (GRCm39) missense probably damaging 1.00
R6122:Kalrn UTSW 16 33,805,561 (GRCm39) missense possibly damaging 0.82
R6128:Kalrn UTSW 16 34,033,255 (GRCm39) missense probably damaging 0.99
R6136:Kalrn UTSW 16 34,177,481 (GRCm39) missense probably damaging 1.00
R6178:Kalrn UTSW 16 33,874,009 (GRCm39) missense possibly damaging 0.88
R6229:Kalrn UTSW 16 33,875,441 (GRCm39) missense probably damaging 1.00
R6376:Kalrn UTSW 16 33,796,361 (GRCm39) missense probably benign
R6397:Kalrn UTSW 16 33,813,355 (GRCm39) missense probably damaging 1.00
R6429:Kalrn UTSW 16 34,152,534 (GRCm39) missense possibly damaging 0.85
R6473:Kalrn UTSW 16 34,025,672 (GRCm39) missense probably damaging 1.00
R6481:Kalrn UTSW 16 34,181,354 (GRCm39) missense probably damaging 1.00
R6597:Kalrn UTSW 16 34,003,117 (GRCm39) missense probably damaging 1.00
R6736:Kalrn UTSW 16 34,038,293 (GRCm39) missense probably damaging 1.00
R6808:Kalrn UTSW 16 33,848,346 (GRCm39) missense probably damaging 1.00
R6897:Kalrn UTSW 16 33,796,073 (GRCm39) missense probably damaging 0.99
R6955:Kalrn UTSW 16 34,040,506 (GRCm39) missense probably damaging 1.00
R7060:Kalrn UTSW 16 34,177,418 (GRCm39) missense probably damaging 0.99
R7064:Kalrn UTSW 16 34,038,261 (GRCm39) missense probably damaging 1.00
R7132:Kalrn UTSW 16 34,076,597 (GRCm39) missense unknown
R7154:Kalrn UTSW 16 34,032,527 (GRCm39) critical splice donor site probably null
R7181:Kalrn UTSW 16 33,983,447 (GRCm39) missense probably benign 0.00
R7234:Kalrn UTSW 16 33,996,792 (GRCm39) missense possibly damaging 0.63
R7235:Kalrn UTSW 16 33,996,131 (GRCm39) missense probably benign 0.18
R7504:Kalrn UTSW 16 34,076,603 (GRCm39) missense unknown
R7563:Kalrn UTSW 16 34,212,464 (GRCm39) missense probably damaging 0.97
R7612:Kalrn UTSW 16 34,134,582 (GRCm39) missense possibly damaging 0.68
R7772:Kalrn UTSW 16 33,851,952 (GRCm39) missense probably benign 0.04
R7796:Kalrn UTSW 16 34,007,854 (GRCm39) nonsense probably null
R7867:Kalrn UTSW 16 33,810,161 (GRCm39) missense possibly damaging 0.94
R7869:Kalrn UTSW 16 33,809,217 (GRCm39) missense probably damaging 0.98
R7914:Kalrn UTSW 16 33,849,122 (GRCm39) missense probably benign
R8080:Kalrn UTSW 16 33,796,038 (GRCm39) missense possibly damaging 0.83
R8147:Kalrn UTSW 16 33,875,414 (GRCm39) missense probably benign
R8239:Kalrn UTSW 16 33,870,153 (GRCm39) missense noncoding transcript
R8281:Kalrn UTSW 16 33,855,431 (GRCm39) nonsense probably null
R8294:Kalrn UTSW 16 33,853,954 (GRCm39) missense probably benign 0.12
R8301:Kalrn UTSW 16 34,177,470 (GRCm39) missense probably benign 0.05
R8686:Kalrn UTSW 16 34,181,305 (GRCm39) missense probably damaging 1.00
R8693:Kalrn UTSW 16 33,854,884 (GRCm39) missense probably damaging 1.00
R8798:Kalrn UTSW 16 33,803,225 (GRCm39) missense possibly damaging 0.65
R8878:Kalrn UTSW 16 34,025,696 (GRCm39) missense probably damaging 1.00
R8878:Kalrn UTSW 16 34,018,830 (GRCm39) missense probably benign 0.05
R8880:Kalrn UTSW 16 34,038,305 (GRCm39) missense probably damaging 1.00
R8883:Kalrn UTSW 16 33,814,025 (GRCm39) missense probably damaging 1.00
R8887:Kalrn UTSW 16 34,047,496 (GRCm39) missense probably benign 0.22
R9048:Kalrn UTSW 16 33,854,854 (GRCm39) missense possibly damaging 0.84
R9111:Kalrn UTSW 16 34,181,371 (GRCm39) missense probably damaging 0.96
R9317:Kalrn UTSW 16 33,834,045 (GRCm39) missense
R9424:Kalrn UTSW 16 33,809,188 (GRCm39) missense probably benign 0.06
R9442:Kalrn UTSW 16 33,916,249 (GRCm39) start codon destroyed probably null 0.56
R9445:Kalrn UTSW 16 33,805,600 (GRCm39) missense probably benign 0.13
R9515:Kalrn UTSW 16 33,854,864 (GRCm39) missense probably damaging 1.00
R9516:Kalrn UTSW 16 33,854,864 (GRCm39) missense probably damaging 1.00
R9625:Kalrn UTSW 16 33,849,197 (GRCm39) critical splice acceptor site probably null
R9645:Kalrn UTSW 16 34,032,583 (GRCm39) missense probably benign 0.01
RF014:Kalrn UTSW 16 33,860,303 (GRCm39) missense probably benign 0.01
Z1177:Kalrn UTSW 16 33,855,876 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGCAGCAGCCATTCCCTATG -3'
(R):5'- TTTGGCCGTGCAACAGGATG -3'

Sequencing Primer
(F):5'- CCTATGGGGCTTGTATTTTGTG -3'
(R):5'- TGCAGAGCAAGCCTGTG -3'
Posted On 2016-12-15