Incidental Mutation 'R0546:Crebbp'
ID44871
Institutional Source Beutler Lab
Gene Symbol Crebbp
Ensembl Gene ENSMUSG00000022521
Gene NameCREB binding protein
SynonymsKAT3A, CBP
MMRRC Submission 038738-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0546 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location4081328-4213997 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4085807 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1856 (I1856N)
Ref Sequence ENSEMBL: ENSMUSP00000023165 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023165] [ENSMUST00000205765]
Predicted Effect probably damaging
Transcript: ENSMUST00000023165
AA Change: I1856N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023165
Gene: ENSMUSG00000022521
AA Change: I1856N

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
low complexity region 75 89 N/A INTRINSIC
low complexity region 95 105 N/A INTRINSIC
low complexity region 213 233 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
ZnF_TAZ 347 432 2.31e-32 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:KIX 586 666 1.4e-42 PFAM
low complexity region 874 893 N/A INTRINSIC
low complexity region 909 958 N/A INTRINSIC
low complexity region 1045 1065 N/A INTRINSIC
BROMO 1085 1195 4.26e-43 SMART
Blast:KAT11 1265 1308 3e-15 BLAST
KAT11 1343 1649 4.25e-137 SMART
ZnF_ZZ 1702 1743 2.17e-15 SMART
ZnF_TAZ 1767 1845 6.8e-30 SMART
low complexity region 1847 1877 N/A INTRINSIC
low complexity region 1884 1914 N/A INTRINSIC
low complexity region 1942 1971 N/A INTRINSIC
Pfam:Creb_binding 2019 2115 8.2e-38 PFAM
low complexity region 2147 2161 N/A INTRINSIC
low complexity region 2197 2216 N/A INTRINSIC
low complexity region 2260 2279 N/A INTRINSIC
low complexity region 2286 2304 N/A INTRINSIC
low complexity region 2343 2378 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191387
Predicted Effect possibly damaging
Transcript: ENSMUST00000205765
AA Change: I1818N

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205945
Predicted Effect probably benign
Transcript: ENSMUST00000206464
Meta Mutation Damage Score 0.238 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is ubiquitously expressed and is involved in the transcriptional coactivation of many different transcription factors. First isolated as a nuclear protein that binds to cAMP-response element binding protein (CREB), this gene is now known to play critical roles in embryonic development, growth control, and homeostasis by coupling chromatin remodeling to transcription factor recognition. The protein encoded by this gene has intrinsic histone acetyltransferase activity and also acts as a scaffold to stabilize additional protein interactions with the transcription complex. This protein acetylates both histone and non-histone proteins. This protein shares regions of very high sequence similarity with protein p300 in its bromodomain, cysteine-histidine-rich regions, and histone acetyltransferase domain. Mutations in this gene cause Rubinstein-Taybi syndrome (RTS). Chromosomal translocations involving this gene have been associated with acute myeloid leukemia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygotes for null or altered alleles die around midgestation with defects in hemopoiesis, blood vessel formation, and neural tube closure. Heterozygotes may exhibit skeletal, cardiac, and hematopoietic defects, retarded growth, and hematologic tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A G 6: 23,077,077 probably null Het
Actn1 C T 12: 80,178,434 R418Q probably benign Het
Adam39 G A 8: 40,826,431 V620M probably damaging Het
Agr3 C A 12: 35,928,330 T14K probably benign Het
Alpk2 T C 18: 65,306,717 D1002G probably benign Het
Amz2 T A 11: 109,433,954 N221K probably benign Het
Aox4 A G 1: 58,250,174 E752G probably damaging Het
Ap2a1 C T 7: 44,904,708 G500S probably damaging Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Ccdc112 A G 18: 46,291,072 S200P possibly damaging Het
Ccdc18 A T 5: 108,174,964 E643D probably benign Het
Ccdc180 A T 4: 45,904,597 T398S possibly damaging Het
Cnp A G 11: 100,580,723 Y397C probably damaging Het
Cpa4 T C 6: 30,580,963 W184R probably damaging Het
Ctrl A G 8: 105,932,334 I200T probably damaging Het
Cyfip1 C T 7: 55,922,816 R934* probably null Het
Dennd5a A G 7: 109,921,426 V408A probably benign Het
Dhfr G A 13: 92,368,184 probably null Het
Dnajc6 A T 4: 101,635,191 N740Y probably damaging Het
Fam110a T C 2: 151,970,812 T13A probably benign Het
Fars2 G T 13: 36,204,586 K19N probably benign Het
Fer1l6 A T 15: 58,558,408 probably null Het
Gabra1 T A 11: 42,162,601 T69S probably damaging Het
Galnt18 T G 7: 111,508,141 N475T probably damaging Het
Gbp4 T C 5: 105,120,970 Y439C probably damaging Het
Gpatch2l A G 12: 86,288,848 *409W probably null Het
Hip1r T C 5: 123,999,051 V658A possibly damaging Het
Hspg2 A G 4: 137,502,294 D73G probably benign Het
Ifitm2 A G 7: 140,955,743 V58A possibly damaging Het
Ift172 T C 5: 31,257,601 D1359G probably benign Het
Ing1 A G 8: 11,557,031 D41G probably damaging Het
Itgal C T 7: 127,310,314 T446I probably benign Het
Itgav G T 2: 83,803,242 M978I probably benign Het
Jazf1 A G 6: 52,777,696 Y132H possibly damaging Het
Lgr4 T A 2: 109,999,421 N211K probably damaging Het
Mgat4d A G 8: 83,355,721 N100S possibly damaging Het
Mrgprb3 T C 7: 48,643,515 Y96C probably damaging Het
Myh11 A C 16: 14,205,628 L1562R probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myo15 A G 11: 60,506,313 Y2667C probably damaging Het
Olfr1084 T A 2: 86,639,229 T160S possibly damaging Het
Olfr1085 C T 2: 86,657,891 C189Y possibly damaging Het
Olfr1158 T A 2: 87,990,472 Y120* probably null Het
Olfr128 T A 17: 37,924,338 C257* probably null Het
Olfr608 A G 7: 103,470,700 I220M possibly damaging Het
Olfr814 G A 10: 129,874,538 T73I possibly damaging Het
Paox G T 7: 140,131,678 G148W probably damaging Het
Pkd1 T C 17: 24,580,138 V2777A probably benign Het
Plod2 T A 9: 92,595,335 V360E probably damaging Het
Prune2 T C 19: 17,020,666 probably benign Het
Sbds G T 5: 130,254,078 A3D possibly damaging Het
Sec23a T C 12: 58,985,167 T426A probably benign Het
Sec31a T C 5: 100,404,070 Y148C probably damaging Het
Shprh T A 10: 11,183,887 probably benign Het
Slc16a7 A G 10: 125,230,873 V299A probably benign Het
Smg8 T C 11: 87,083,613 Y174C possibly damaging Het
Snx22 T A 9: 66,068,777 Y58F probably damaging Het
Snx25 A G 8: 46,103,630 Y308H probably benign Het
St3gal2 A G 8: 110,970,106 probably null Het
Stab1 C T 14: 31,139,550 R2500H possibly damaging Het
Steap4 T C 5: 7,975,870 S144P probably damaging Het
Stfa3 T A 16: 36,452,257 probably benign Het
Tmprss9 C A 10: 80,899,323 Q1095K probably benign Het
Top2a A G 11: 98,999,226 V1217A possibly damaging Het
Trhr2 A G 8: 122,358,489 probably null Het
Trim7 A G 11: 48,845,509 E23G probably damaging Het
Trpv3 A T 11: 73,297,187 E788V probably damaging Het
Ttn A G 2: 76,745,519 I25010T probably damaging Het
Ube2ql1 T C 13: 69,739,300 H14R unknown Het
Uggt1 C T 1: 36,195,971 R419H probably benign Het
Xpo4 A G 14: 57,613,274 V391A probably benign Het
Zfhx3 A G 8: 108,794,187 D647G probably damaging Het
Zfp354c A T 11: 50,815,630 M206K probably benign Het
Zfp804a A G 2: 82,258,920 N1031S possibly damaging Het
Zfp868 A G 8: 69,612,231 V151A probably benign Het
Other mutations in Crebbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Crebbp APN 16 4179552 missense probably benign
IGL01366:Crebbp APN 16 4126506 missense probably damaging 1.00
IGL01457:Crebbp APN 16 4124768 missense probably damaging 0.99
IGL01713:Crebbp APN 16 4128648 missense possibly damaging 0.79
IGL02382:Crebbp APN 16 4108070 missense probably damaging 1.00
IGL02513:Crebbp APN 16 4126605 unclassified probably null
IGL02519:Crebbp APN 16 4101593 missense possibly damaging 0.80
IGL02533:Crebbp APN 16 4107432 missense probably damaging 1.00
IGL02582:Crebbp APN 16 4084277 missense possibly damaging 0.87
IGL02600:Crebbp APN 16 4155018 missense probably benign
IGL02716:Crebbp APN 16 4114878 missense probably benign 0.22
IGL02736:Crebbp APN 16 4154910 missense probably benign 0.00
IGL03349:Crebbp APN 16 4117358 missense possibly damaging 0.69
PIT4418001:Crebbp UTSW 16 4114825 missense probably benign 0.02
R0022:Crebbp UTSW 16 4085228 missense probably damaging 1.00
R0029:Crebbp UTSW 16 4117443 missense probably damaging 1.00
R0098:Crebbp UTSW 16 4091928 missense probably damaging 1.00
R0098:Crebbp UTSW 16 4091928 missense probably damaging 1.00
R0125:Crebbp UTSW 16 4117241 splice site probably benign
R0126:Crebbp UTSW 16 4084063 missense possibly damaging 0.94
R0140:Crebbp UTSW 16 4117499 missense probably damaging 1.00
R0705:Crebbp UTSW 16 4155010 missense possibly damaging 0.95
R0801:Crebbp UTSW 16 4088276 missense probably damaging 1.00
R1103:Crebbp UTSW 16 4084061 missense probably damaging 0.97
R1225:Crebbp UTSW 16 4126956 missense probably benign 0.04
R1421:Crebbp UTSW 16 4124647 missense probably damaging 1.00
R1513:Crebbp UTSW 16 4115885 missense probably damaging 1.00
R1531:Crebbp UTSW 16 4084517 missense probably benign 0.04
R1860:Crebbp UTSW 16 4087736 missense possibly damaging 0.68
R1941:Crebbp UTSW 16 4179691 missense probably benign
R1953:Crebbp UTSW 16 4179449 missense probably benign 0.23
R1992:Crebbp UTSW 16 4128697 splice site probably null
R2000:Crebbp UTSW 16 4084252 missense probably damaging 0.98
R2006:Crebbp UTSW 16 4084753 unclassified probably benign
R2022:Crebbp UTSW 16 4085819 missense probably damaging 1.00
R2044:Crebbp UTSW 16 4084823 missense probably benign 0.04
R2185:Crebbp UTSW 16 4084138 missense probably damaging 0.99
R2203:Crebbp UTSW 16 4138777 missense possibly damaging 0.72
R2349:Crebbp UTSW 16 4138910 missense probably damaging 1.00
R2430:Crebbp UTSW 16 4096465 missense probably damaging 1.00
R2438:Crebbp UTSW 16 4154858 missense possibly damaging 0.90
R2842:Crebbp UTSW 16 4109198 missense probably damaging 1.00
R2896:Crebbp UTSW 16 4138816 missense probably damaging 1.00
R2920:Crebbp UTSW 16 4119082 missense probably damaging 0.98
R3118:Crebbp UTSW 16 4109198 missense probably damaging 1.00
R3894:Crebbp UTSW 16 4096102 missense probably benign 0.11
R4177:Crebbp UTSW 16 4119799 missense possibly damaging 0.48
R4692:Crebbp UTSW 16 4114863 missense possibly damaging 0.64
R4790:Crebbp UTSW 16 4180119 missense probably damaging 0.98
R4884:Crebbp UTSW 16 4088375 missense probably damaging 1.00
R4957:Crebbp UTSW 16 4117367 missense probably benign 0.14
R5109:Crebbp UTSW 16 4088431 intron probably benign
R5121:Crebbp UTSW 16 4093511 missense probably damaging 1.00
R5420:Crebbp UTSW 16 4107458 missense probably damaging 1.00
R5455:Crebbp UTSW 16 4085967 missense probably benign 0.45
R5485:Crebbp UTSW 16 4114913 missense probably benign
R5660:Crebbp UTSW 16 4154858 missense possibly damaging 0.90
R5724:Crebbp UTSW 16 4087635 unclassified probably benign
R5771:Crebbp UTSW 16 4119772 missense probably benign 0.03
R5825:Crebbp UTSW 16 4087742 missense probably damaging 0.99
R5919:Crebbp UTSW 16 4108127 missense probably damaging 1.00
R5965:Crebbp UTSW 16 4087661 unclassified probably benign
R6021:Crebbp UTSW 16 4085418 missense probably damaging 1.00
R6146:Crebbp UTSW 16 4084623 nonsense probably null
R6521:Crebbp UTSW 16 4119128 missense probably damaging 0.99
R6571:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6617:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6618:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6634:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6646:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6647:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6766:Crebbp UTSW 16 4117500 missense probably damaging 1.00
R6836:Crebbp UTSW 16 4180022 missense possibly damaging 0.83
R7022:Crebbp UTSW 16 4117323 missense probably damaging 0.98
R7210:Crebbp UTSW 16 4084257 missense possibly damaging 0.95
X0012:Crebbp UTSW 16 4087765 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCAATTTGCCGGGCTGCTTC -3'
(R):5'- TGTCGCAATGCCAACTGCTCAC -3'

Sequencing Primer
(F):5'- GCTTCCCAGCAGACACTATTG -3'
(R):5'- CGTCTTGCCAGAAGATGAAGC -3'
Posted On2013-06-11