Incidental Mutation 'R5775:Kdm4c'
ID448717
Institutional Source Beutler Lab
Gene Symbol Kdm4c
Ensembl Gene ENSMUSG00000028397
Gene Namelysine (K)-specific demethylase 4C
SynonymsJmjd2c, 2410141F18Rik
MMRRC Submission 043374-MU
Accession Numbers

Genbank: NM_001172095; MGI: 1924054

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5775 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location74242497-74405860 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 74359431 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 774 (V774G)
Ref Sequence ENSEMBL: ENSMUSP00000077017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030102] [ENSMUST00000077851]
Predicted Effect probably damaging
Transcript: ENSMUST00000030102
AA Change: V774G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030102
Gene: ENSMUSG00000028397
AA Change: V774G

DomainStartEndE-ValueType
JmjN 15 57 9.12e-14 SMART
JmjC 144 310 1.31e-61 SMART
low complexity region 361 374 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
PHD 687 745 3.3e-5 SMART
PHD 807 863 8.71e-5 SMART
TUDOR 875 932 2.96e-10 SMART
TUDOR 933 989 2e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077851
AA Change: V774G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077017
Gene: ENSMUSG00000028397
AA Change: V774G

DomainStartEndE-ValueType
JmjN 15 57 9.12e-14 SMART
JmjC 144 310 1.31e-61 SMART
low complexity region 361 374 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
PHD 687 745 3.3e-5 SMART
PHD 807 863 8.71e-5 SMART
TUDOR 875 932 2.96e-10 SMART
TUDOR 933 989 2e-7 SMART
Meta Mutation Damage Score 0.388 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Jumonji domain 2 (JMJD2) family. The encoded protein is a trimethylation-specific demethylase, and converts specific trimethylated histone residues to the dimethylated form. This enzymatic action regulates gene expression and chromosome segregation. Chromosomal aberrations and changes in expression of this gene may be found in tumor cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a null gene trap allele cannot be produced likely due to embryonic lethality. Mice heterozygous for a null gene trap allele exhibit reduced body weight and lower incidence and multiplicity of both benign and malignant tumors in mice treated with DMBA and TPA. [provided by MGI curators]
Allele List at MGI

All alleles(402) : Targeted, other(2) Gene trapped(400)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A G 12: 113,546,266 D753G possibly damaging Het
AF067061 T A 13: 120,263,939 C46* probably null Het
Arpc2 T A 1: 74,255,949 probably null Het
Atxn2 C T 5: 121,813,449 T619M probably damaging Het
Cacna1s T C 1: 136,108,122 Y1120H probably damaging Het
Calm5 T C 13: 3,854,435 L20S probably damaging Het
Carmil1 T C 13: 24,276,537 I20V probably benign Het
Cd177 T C 7: 24,752,268 E441G probably damaging Het
Cd63 T A 10: 128,910,430 C9S probably damaging Het
Cep250 A C 2: 155,969,374 D380A possibly damaging Het
Col5a3 G T 9: 20,801,072 P509Q unknown Het
Cyp11b2 A G 15: 74,853,478 V264A probably benign Het
Dennd6a T A 14: 26,619,373 L214* probably null Het
Dna2 A G 10: 62,949,242 N46S possibly damaging Het
Elovl1 G A 4: 118,430,897 V77I probably benign Het
Eml1 A T 12: 108,506,554 Y207F probably damaging Het
Epha6 C T 16: 59,818,994 R839Q possibly damaging Het
Erlec1 A T 11: 30,943,848 S105T probably benign Het
Esp3 T A 17: 40,633,577 S37T possibly damaging Het
Foxh1 G A 15: 76,669,849 A8V probably benign Het
Fut1 A C 7: 45,619,462 D280A probably damaging Het
Gm13998 G T 2: 119,878,411 noncoding transcript Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
H2afz T C 3: 137,865,619 Y61H probably damaging Het
Kcns1 T C 2: 164,164,766 I426V probably damaging Het
Mrc2 G A 11: 105,337,813 V673I probably benign Het
Mtnr1b G A 9: 15,862,872 A297V possibly damaging Het
Olfr1173 A T 2: 88,274,701 M116K probably damaging Het
Olfr889 A T 9: 38,116,127 E110D probably damaging Het
Osbpl5 A T 7: 143,704,529 V346D probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Pigo T C 4: 43,023,475 D233G probably damaging Het
Pmm1 A T 15: 81,951,955 I152N probably benign Het
Pot1a A T 6: 25,757,298 probably null Het
Ppp1r12b G T 1: 134,876,042 L460I probably benign Het
Prrc2a T C 17: 35,158,487 D565G unknown Het
Psd C A 19: 46,314,772 E724* probably null Het
Rasa2 C T 9: 96,577,468 probably null Het
Rsbn1 A T 3: 103,962,572 Q783L possibly damaging Het
Ryr2 T C 13: 11,769,962 Y1035C probably damaging Het
Sec24d C T 3: 123,290,460 A96V probably benign Het
Sec61a2 A T 2: 5,882,774 probably null Het
Sec62 A G 3: 30,793,287 probably benign Het
Tmem132b T A 5: 125,638,330 probably null Het
Tnip3 A G 6: 65,614,757 S247G probably benign Het
Traf3 A G 12: 111,252,728 K263R possibly damaging Het
Tubgcp3 A T 8: 12,625,056 I713N probably damaging Het
Unc5c A G 3: 141,828,520 E860G probably damaging Het
Usp44 A G 10: 93,845,978 S97G possibly damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps37a A G 8: 40,529,119 H109R probably damaging Het
Wfikkn2 G T 11: 94,238,288 D342E probably benign Het
Zfp354b A T 11: 50,922,820 F426Y probably benign Het
Zfp462 C A 4: 55,010,590 T852N probably damaging Het
Zfp987 T G 4: 146,124,935 S312R probably benign Het
Other mutations in Kdm4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Kdm4c APN 4 74345501 missense probably benign 0.19
IGL00225:Kdm4c APN 4 74345567 missense probably benign 0.03
IGL00672:Kdm4c APN 4 74343514 missense probably benign 0.00
IGL00897:Kdm4c APN 4 74373684 missense probably damaging 1.00
IGL01479:Kdm4c APN 4 74343501 missense probably benign 0.18
IGL01707:Kdm4c APN 4 74336927 missense probably damaging 1.00
IGL02142:Kdm4c APN 4 74307016 critical splice donor site probably null
IGL02268:Kdm4c APN 4 74373716 missense possibly damaging 0.94
IGL02662:Kdm4c APN 4 74404821 missense probably damaging 0.99
IGL03377:Kdm4c APN 4 74271255 missense possibly damaging 0.82
3-1:Kdm4c UTSW 4 74334673 missense probably benign 0.00
PIT4434001:Kdm4c UTSW 4 74271332 missense probably benign 0.01
R0096:Kdm4c UTSW 4 74357343 missense probably damaging 1.00
R0096:Kdm4c UTSW 4 74357343 missense probably damaging 1.00
R0219:Kdm4c UTSW 4 74373620 missense probably damaging 1.00
R0309:Kdm4c UTSW 4 74345567 missense probably benign 0.00
R0512:Kdm4c UTSW 4 74333794 missense probably benign
R1070:Kdm4c UTSW 4 74373628 nonsense probably null
R1518:Kdm4c UTSW 4 74333826 missense probably benign
R1713:Kdm4c UTSW 4 74298484 missense probably benign 0.10
R1769:Kdm4c UTSW 4 74280997 missense possibly damaging 0.66
R1927:Kdm4c UTSW 4 74345483 missense probably benign 0.00
R1962:Kdm4c UTSW 4 74307016 intron probably benign
R1992:Kdm4c UTSW 4 74343394 missense possibly damaging 0.71
R2389:Kdm4c UTSW 4 74333870 critical splice donor site probably null
R2979:Kdm4c UTSW 4 74373728 nonsense probably null
R3966:Kdm4c UTSW 4 74298583 missense probably damaging 1.00
R4094:Kdm4c UTSW 4 74311678 missense probably benign
R4171:Kdm4c UTSW 4 74280898 missense possibly damaging 0.73
R4543:Kdm4c UTSW 4 74330760 missense probably benign 0.01
R4581:Kdm4c UTSW 4 74357339 splice site probably null
R5019:Kdm4c UTSW 4 74343535 missense probably damaging 1.00
R5088:Kdm4c UTSW 4 74334699 missense probably benign
R5533:Kdm4c UTSW 4 74315649 intron probably benign
R5663:Kdm4c UTSW 4 74399348 missense probably damaging 1.00
R5691:Kdm4c UTSW 4 74334728 missense probably benign
R5786:Kdm4c UTSW 4 74359485 missense probably damaging 0.98
R6002:Kdm4c UTSW 4 74404969 missense possibly damaging 0.95
R6375:Kdm4c UTSW 4 74330715 missense probably damaging 0.96
R6491:Kdm4c UTSW 4 74373636 missense probably damaging 1.00
R6790:Kdm4c UTSW 4 74391461 missense probably damaging 1.00
R6952:Kdm4c UTSW 4 74357350 missense probably damaging 1.00
R7157:Kdm4c UTSW 4 74345567 missense probably benign 0.01
R7319:Kdm4c UTSW 4 74336963 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTTAGTCCTTGGCCTTTATATGG -3'
(R):5'- ATGAGGCCTGTTATGGAGACTTAC -3'

Sequencing Primer
(F):5'- AGGAACTGCTGAGCCATTTC -3'
(R):5'- GCCTGTTATGGAGACTTACAATATAC -3'
Posted On2016-12-15