Incidental Mutation 'R5802:Rap1a'
ID448769
Institutional Source Beutler Lab
Gene Symbol Rap1a
Ensembl Gene ENSMUSG00000068798
Gene NameRAS-related protein 1a
SynonymsRap1, Krev-1
MMRRC Submission 043391-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock #R5802 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location105727267-105801336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105745936 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 32 (Y32H)
Ref Sequence ENSEMBL: ENSMUSP00000142634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090678] [ENSMUST00000197094] [ENSMUST00000198004] [ENSMUST00000199969]
Predicted Effect probably damaging
Transcript: ENSMUST00000090678
AA Change: Y32H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088174
Gene: ENSMUSG00000068798
AA Change: Y32H

DomainStartEndE-ValueType
RAS 1 168 2.68e-120 SMART
low complexity region 173 179 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000197094
AA Change: Y32H

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142419
Gene: ENSMUSG00000068798
AA Change: Y32H

DomainStartEndE-ValueType
RAS 1 102 1.5e-45 SMART
low complexity region 107 113 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198004
AA Change: Y32H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142733
Gene: ENSMUSG00000068798
AA Change: Y32H

DomainStartEndE-ValueType
RAS 1 109 1.9e-55 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000199969
AA Change: Y32H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142634
Gene: ENSMUSG00000068798
AA Change: Y32H

DomainStartEndE-ValueType
RAS 1 158 2.53e-107 SMART
Meta Mutation Damage Score 0.338 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras family of small GTPases. The encoded protein undergoes a change in conformational state and activity, depending on whether it is bound to GTP or GDP. This protein is activated by several types of guanine nucleotide exchange factors (GEFs), and inactivated by two groups of GTPase-activating proteins (GAPs). The activation status of the encoded protein is therefore affected by the balance of intracellular levels of GEFs and GAPs. The encoded protein regulates signaling pathways that affect cell proliferation and adhesion, and may play a role in tumor malignancy. Pseudogenes of this gene have been defined on chromosomes 14 and 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired leukocyte migration and decreased angiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,950,964 D383V probably damaging Het
Abca4 A T 3: 122,054,232 L67F probably damaging Het
Abcc9 C A 6: 142,656,676 probably null Het
Atp2a3 T C 11: 72,972,882 V175A probably damaging Het
B3galt4 T A 17: 33,950,757 D169V probably damaging Het
Bsn C T 9: 108,113,009 R1848Q possibly damaging Het
Camkk2 T C 5: 122,734,244 E90G probably damaging Het
Cdon T A 9: 35,454,420 I155N probably damaging Het
Cep70 A G 9: 99,296,405 N519D probably damaging Het
Clgn T C 8: 83,425,614 S582P probably damaging Het
Cnga3 T C 1: 37,260,925 F280S probably damaging Het
Dennd4c C T 4: 86,811,453 T764M probably benign Het
Dis3 A T 14: 99,099,664 S4T probably damaging Het
Dlgap1 T C 17: 70,766,091 probably null Het
Dnah17 C T 11: 118,036,446 V3839I possibly damaging Het
Dnajc1 A G 2: 18,284,739 Y286H probably benign Het
Dynap T A 18: 70,241,002 D151V unknown Het
Ednrb A G 14: 103,821,714 F292S probably damaging Het
Eef1a1 A G 9: 78,479,036 S396P probably damaging Het
Fancg A G 4: 43,006,582 F324S probably benign Het
Fbxw11 T A 11: 32,711,790 S56T probably benign Het
Gm13178 T A 4: 144,703,636 D261V probably damaging Het
Gm14409 T C 2: 177,265,256 T150A possibly damaging Het
Gm17535 G C 9: 3,035,758 V209L probably benign Homo
Gm20767 G A 13: 120,154,913 S96N possibly damaging Het
Gm5592 C T 7: 41,219,105 probably benign Het
Gm7030 A G 17: 36,111,287 probably benign Het
Gpr137 C T 19: 6,942,005 W51* probably null Het
Hbb-bs T C 7: 103,826,672 Y146C probably damaging Het
Herc1 G T 9: 66,462,878 C2982F probably damaging Het
Hnrnpa3 T A 2: 75,665,056 N309K unknown Het
Hydin A T 8: 110,452,060 I1096F possibly damaging Het
Klf12 A G 14: 100,022,894 V133A probably benign Het
Lats2 A T 14: 57,694,418 Y848N probably damaging Het
Loxl3 A G 6: 83,049,289 T453A possibly damaging Het
Ltn1 T G 16: 87,415,681 H664P probably benign Het
Lypd6 C T 2: 50,173,601 T40I probably benign Het
Nbeal1 A T 1: 60,272,221 T1817S probably benign Het
Nub1 A C 5: 24,702,441 Y350S possibly damaging Het
Pbp2 A G 6: 135,309,876 Y158H possibly damaging Het
Ptpru C T 4: 131,788,377 E827K possibly damaging Het
Raph1 T C 1: 60,488,673 N1143S possibly damaging Het
Rbl1 T C 2: 157,161,433 T859A probably benign Het
Rom1 A G 19: 8,928,824 L117P probably damaging Het
Senp6 T C 9: 80,118,644 probably benign Het
Sirpb1c T C 3: 15,832,076 M379V probably benign Het
Slc6a4 C T 11: 77,019,236 T439M probably damaging Het
Srsf12 G T 4: 33,230,929 R141L probably damaging Het
Stk10 C T 11: 32,596,748 P335L probably benign Het
Tecpr1 A T 5: 144,206,546 N670K probably benign Het
Tgds T C 14: 118,132,707 E8G probably benign Het
Tmem129 A G 5: 33,657,716 S38P probably damaging Het
Trappc9 T C 15: 72,685,339 E812G probably damaging Het
Trmt10b T A 4: 45,314,236 probably benign Het
Wapl A G 14: 34,692,320 T380A probably damaging Het
Xylt1 A T 7: 117,656,691 T829S probably benign Het
Zc3h6 C T 2: 129,015,559 P666L possibly damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Rap1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Rap1a APN 3 105732035 missense probably benign 0.01
IGL03168:Rap1a APN 3 105750271 missense probably damaging 1.00
R2139:Rap1a UTSW 3 105739540 missense probably damaging 0.98
R5906:Rap1a UTSW 3 105737765 missense possibly damaging 0.90
R5941:Rap1a UTSW 3 105732069 missense possibly damaging 0.82
R6051:Rap1a UTSW 3 105750297 missense possibly damaging 0.91
R6136:Rap1a UTSW 3 105750282 missense probably damaging 1.00
R6251:Rap1a UTSW 3 105731995 nonsense probably null
R6856:Rap1a UTSW 3 105732068 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGAGGCGTGTTTTATCCAG -3'
(R):5'- AAGCAGTGTAGTAGCAGTATTGAC -3'

Sequencing Primer
(F):5'- TTTATCCAGGTAGCACAGGC -3'
(R):5'- GACAAGTTTTTAATATGACCATCGC -3'
Posted On2016-12-15