Incidental Mutation 'R5802:Fancg'
ID448773
Institutional Source Beutler Lab
Gene Symbol Fancg
Ensembl Gene ENSMUSG00000028453
Gene NameFanconi anemia, complementation group G
SynonymsXrcc9
MMRRC Submission 043391-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock #R5802 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43002343-43010506 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43006582 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 324 (F324S)
Ref Sequence ENSEMBL: ENSMUSP00000030165 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030165]
Predicted Effect probably benign
Transcript: ENSMUST00000030165
AA Change: F324S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030165
Gene: ENSMUSG00000028453
AA Change: F324S

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
low complexity region 131 144 N/A INTRINSIC
low complexity region 164 179 N/A INTRINSIC
low complexity region 190 199 N/A INTRINSIC
Pfam:TPR_1 251 280 4.1e-6 PFAM
Pfam:TPR_2 251 281 7.3e-5 PFAM
Pfam:TPR_8 251 281 4.5e-3 PFAM
low complexity region 302 317 N/A INTRINSIC
low complexity region 401 418 N/A INTRINSIC
Blast:TPR 458 491 4e-9 BLAST
Blast:TPR 518 550 2e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148018
Meta Mutation Damage Score 0.1196 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group G. [provided by RefSeq, Jul 2008]
PHENOTYPE: Females and males homozygous for targeted null mutations exhibit hypogonadism and reduced fertility. Cytogeneic analysis showed somatic chromosome aberrations occur at a higher spontaneous rate and are easier to induce than in normal cells. Cells are also more sensitive to mitomycin C. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,950,964 D383V probably damaging Het
Abca4 A T 3: 122,054,232 L67F probably damaging Het
Abcc9 C A 6: 142,656,676 probably null Het
Atp2a3 T C 11: 72,972,882 V175A probably damaging Het
B3galt4 T A 17: 33,950,757 D169V probably damaging Het
Bsn C T 9: 108,113,009 R1848Q possibly damaging Het
Camkk2 T C 5: 122,734,244 E90G probably damaging Het
Cdon T A 9: 35,454,420 I155N probably damaging Het
Cep70 A G 9: 99,296,405 N519D probably damaging Het
Clgn T C 8: 83,425,614 S582P probably damaging Het
Cnga3 T C 1: 37,260,925 F280S probably damaging Het
Dennd4c C T 4: 86,811,453 T764M probably benign Het
Dis3 A T 14: 99,099,664 S4T probably damaging Het
Dlgap1 T C 17: 70,766,091 probably null Het
Dnah17 C T 11: 118,036,446 V3839I possibly damaging Het
Dnajc1 A G 2: 18,284,739 Y286H probably benign Het
Dynap T A 18: 70,241,002 D151V unknown Het
Ednrb A G 14: 103,821,714 F292S probably damaging Het
Eef1a1 A G 9: 78,479,036 S396P probably damaging Het
Fbxw11 T A 11: 32,711,790 S56T probably benign Het
Gm13178 T A 4: 144,703,636 D261V probably damaging Het
Gm14409 T C 2: 177,265,256 T150A possibly damaging Het
Gm17535 G C 9: 3,035,758 V209L probably benign Homo
Gm20767 G A 13: 120,154,913 S96N possibly damaging Het
Gm5592 C T 7: 41,219,105 probably benign Het
Gm7030 A G 17: 36,111,287 probably benign Het
Gpr137 C T 19: 6,942,005 W51* probably null Het
Hbb-bs T C 7: 103,826,672 Y146C probably damaging Het
Herc1 G T 9: 66,462,878 C2982F probably damaging Het
Hnrnpa3 T A 2: 75,665,056 N309K unknown Het
Hydin A T 8: 110,452,060 I1096F possibly damaging Het
Klf12 A G 14: 100,022,894 V133A probably benign Het
Lats2 A T 14: 57,694,418 Y848N probably damaging Het
Loxl3 A G 6: 83,049,289 T453A possibly damaging Het
Ltn1 T G 16: 87,415,681 H664P probably benign Het
Lypd6 C T 2: 50,173,601 T40I probably benign Het
Nbeal1 A T 1: 60,272,221 T1817S probably benign Het
Nub1 A C 5: 24,702,441 Y350S possibly damaging Het
Pbp2 A G 6: 135,309,876 Y158H possibly damaging Het
Ptpru C T 4: 131,788,377 E827K possibly damaging Het
Rap1a A G 3: 105,745,936 Y32H probably damaging Het
Raph1 T C 1: 60,488,673 N1143S possibly damaging Het
Rbl1 T C 2: 157,161,433 T859A probably benign Het
Rom1 A G 19: 8,928,824 L117P probably damaging Het
Senp6 T C 9: 80,118,644 probably benign Het
Sirpb1c T C 3: 15,832,076 M379V probably benign Het
Slc6a4 C T 11: 77,019,236 T439M probably damaging Het
Srsf12 G T 4: 33,230,929 R141L probably damaging Het
Stk10 C T 11: 32,596,748 P335L probably benign Het
Tecpr1 A T 5: 144,206,546 N670K probably benign Het
Tgds T C 14: 118,132,707 E8G probably benign Het
Tmem129 A G 5: 33,657,716 S38P probably damaging Het
Trappc9 T C 15: 72,685,339 E812G probably damaging Het
Trmt10b T A 4: 45,314,236 probably benign Het
Wapl A G 14: 34,692,320 T380A probably damaging Het
Xylt1 A T 7: 117,656,691 T829S probably benign Het
Zc3h6 C T 2: 129,015,559 P666L possibly damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Fancg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Fancg APN 4 43003910 nonsense probably null
IGL02072:Fancg APN 4 43007062 missense probably benign 0.00
IGL02184:Fancg APN 4 43006872 missense possibly damaging 0.79
IGL02989:Fancg APN 4 43007121 splice site probably benign
R0671:Fancg UTSW 4 43002998 missense probably benign 0.00
R1581:Fancg UTSW 4 43007039 missense probably damaging 1.00
R1853:Fancg UTSW 4 43009727 missense probably benign 0.00
R2046:Fancg UTSW 4 43004604 missense probably damaging 1.00
R2519:Fancg UTSW 4 43008787 missense probably damaging 1.00
R4282:Fancg UTSW 4 43003830 missense probably damaging 1.00
R4397:Fancg UTSW 4 43008897 missense probably benign 0.02
R4583:Fancg UTSW 4 43002991 missense probably benign
R4671:Fancg UTSW 4 43005272 missense probably benign 0.01
R4887:Fancg UTSW 4 43006866 missense probably benign 0.18
R5309:Fancg UTSW 4 43003019 missense probably benign 0.23
R5312:Fancg UTSW 4 43003019 missense probably benign 0.23
R5325:Fancg UTSW 4 43006564 missense probably damaging 0.99
R5379:Fancg UTSW 4 43002998 missense probably benign 0.00
R5386:Fancg UTSW 4 43007076 nonsense probably null
R5649:Fancg UTSW 4 43008736 missense probably damaging 1.00
R5788:Fancg UTSW 4 43007130 intron probably benign
R6217:Fancg UTSW 4 43010084 missense probably benign 0.03
R6698:Fancg UTSW 4 43007034 missense probably benign 0.00
R7092:Fancg UTSW 4 43004831 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GAACCACATGTCCAGTGAAAGC -3'
(R):5'- GGCTTCCAGAGTATATAGGCAAC -3'

Sequencing Primer
(F):5'- CATGTCCAGTGAAAGCATCAG -3'
(R):5'- AGATGGGTGTGGTTCACA -3'
Posted On2016-12-15