Incidental Mutation 'R5802:Rom1'
ID448813
Institutional Source Beutler Lab
Gene Symbol Rom1
Ensembl Gene ENSMUSG00000071648
Gene Namerod outer segment membrane protein 1
SynonymsRgsc1156, Tspan23, Rom-1, M101156
MMRRC Submission 043391-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R5802 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location8927382-8929356 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8928824 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 117 (L117P)
Ref Sequence ENSEMBL: ENSMUSP00000093961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096241] [ENSMUST00000096242] [ENSMUST00000096243] [ENSMUST00000224272]
Predicted Effect probably benign
Transcript: ENSMUST00000096241
SMART Domains Protein: ENSMUSP00000093960
Gene: ENSMUSG00000071647

DomainStartEndE-ValueType
coiled coil region 12 47 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
low complexity region 118 139 N/A INTRINSIC
low complexity region 149 168 N/A INTRINSIC
low complexity region 198 208 N/A INTRINSIC
Pfam:HELP 215 286 5.3e-30 PFAM
WD40 295 344 6.34e-2 SMART
Blast:WD40 347 392 5e-22 BLAST
WD40 395 434 1.56e-1 SMART
WD40 450 487 2.64e2 SMART
WD40 504 543 3.33e-1 SMART
WD40 587 626 2.69e-5 SMART
WD40 670 709 1.7e-2 SMART
WD40 716 755 1.52e-4 SMART
WD40 829 869 1.29e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000096242
AA Change: L117P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093961
Gene: ENSMUSG00000071648
AA Change: L117P

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Tetraspannin 17 291 1e-18 PFAM
low complexity region 331 346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096243
SMART Domains Protein: ENSMUSP00000093962
Gene: ENSMUSG00000071649

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 58 75 N/A INTRINSIC
Pfam:Glyco_transf_43 96 312 1.8e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224272
Meta Mutation Damage Score 0.022 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a photoreceptor-specific gene family and encodes an integral membrane protein found in the photoreceptor disk rim of the eye. This protein can form homodimers or can heterodimerize with another photoreceptor, retinal degeneration slow (RDS). It is essential for disk morphogenesis, and may also function as an adhesion molecule involved in the stabilization and compaction of outer segment disks or in the maintenance of the curvature of the rim. Certain defects in this gene have been associated with the degenerative eye disease retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit large retinal discs, disorganized outer segments, gradual loss of rod photoreceptors by apoptosis, and diminished photo responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,950,964 D383V probably damaging Het
Abca4 A T 3: 122,054,232 L67F probably damaging Het
Abcc9 C A 6: 142,656,676 probably null Het
Atp2a3 T C 11: 72,972,882 V175A probably damaging Het
B3galt4 T A 17: 33,950,757 D169V probably damaging Het
Bsn C T 9: 108,113,009 R1848Q possibly damaging Het
Camkk2 T C 5: 122,734,244 E90G probably damaging Het
Cdon T A 9: 35,454,420 I155N probably damaging Het
Cep70 A G 9: 99,296,405 N519D probably damaging Het
Clgn T C 8: 83,425,614 S582P probably damaging Het
Cnga3 T C 1: 37,260,925 F280S probably damaging Het
Dennd4c C T 4: 86,811,453 T764M probably benign Het
Dis3 A T 14: 99,099,664 S4T probably damaging Het
Dlgap1 T C 17: 70,766,091 probably null Het
Dnah17 C T 11: 118,036,446 V3839I possibly damaging Het
Dnajc1 A G 2: 18,284,739 Y286H probably benign Het
Dynap T A 18: 70,241,002 D151V unknown Het
Ednrb A G 14: 103,821,714 F292S probably damaging Het
Eef1a1 A G 9: 78,479,036 S396P probably damaging Het
Fancg A G 4: 43,006,582 F324S probably benign Het
Fbxw11 T A 11: 32,711,790 S56T probably benign Het
Gm13178 T A 4: 144,703,636 D261V probably damaging Het
Gm14409 T C 2: 177,265,256 T150A possibly damaging Het
Gm17535 G C 9: 3,035,758 V209L probably benign Homo
Gm20767 G A 13: 120,154,913 S96N possibly damaging Het
Gm5592 C T 7: 41,219,105 probably benign Het
Gm7030 A G 17: 36,111,287 probably benign Het
Gpr137 C T 19: 6,942,005 W51* probably null Het
Hbb-bs T C 7: 103,826,672 Y146C probably damaging Het
Herc1 G T 9: 66,462,878 C2982F probably damaging Het
Hnrnpa3 T A 2: 75,665,056 N309K unknown Het
Hydin A T 8: 110,452,060 I1096F possibly damaging Het
Klf12 A G 14: 100,022,894 V133A probably benign Het
Lats2 A T 14: 57,694,418 Y848N probably damaging Het
Loxl3 A G 6: 83,049,289 T453A possibly damaging Het
Ltn1 T G 16: 87,415,681 H664P probably benign Het
Lypd6 C T 2: 50,173,601 T40I probably benign Het
Nbeal1 A T 1: 60,272,221 T1817S probably benign Het
Nub1 A C 5: 24,702,441 Y350S possibly damaging Het
Pbp2 A G 6: 135,309,876 Y158H possibly damaging Het
Ptpru C T 4: 131,788,377 E827K possibly damaging Het
Rap1a A G 3: 105,745,936 Y32H probably damaging Het
Raph1 T C 1: 60,488,673 N1143S possibly damaging Het
Rbl1 T C 2: 157,161,433 T859A probably benign Het
Senp6 T C 9: 80,118,644 probably benign Het
Sirpb1c T C 3: 15,832,076 M379V probably benign Het
Slc6a4 C T 11: 77,019,236 T439M probably damaging Het
Srsf12 G T 4: 33,230,929 R141L probably damaging Het
Stk10 C T 11: 32,596,748 P335L probably benign Het
Tecpr1 A T 5: 144,206,546 N670K probably benign Het
Tgds T C 14: 118,132,707 E8G probably benign Het
Tmem129 A G 5: 33,657,716 S38P probably damaging Het
Trappc9 T C 15: 72,685,339 E812G probably damaging Het
Trmt10b T A 4: 45,314,236 probably benign Het
Wapl A G 14: 34,692,320 T380A probably damaging Het
Xylt1 A T 7: 117,656,691 T829S probably benign Het
Zc3h6 C T 2: 129,015,559 P666L possibly damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Rom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02008:Rom1 APN 19 8928004 missense probably benign 0.30
IGL02118:Rom1 APN 19 8929022 missense possibly damaging 0.92
R0800:Rom1 UTSW 19 8928908 missense probably damaging 0.99
R4555:Rom1 UTSW 19 8928016 missense possibly damaging 0.89
R6992:Rom1 UTSW 19 8929205 unclassified probably benign
X0067:Rom1 UTSW 19 8929136 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAATCCTTGTAGCCATGGC -3'
(R):5'- TCACCCTCCTTTGTAGCGGG -3'

Sequencing Primer
(F):5'- CGCCCGCAGCAATGGTAC -3'
(R):5'- TGGCACCTTCCTGGCAC -3'
Posted On2016-12-15