Incidental Mutation 'R0547:Prkag3'
ID44883
Institutional Source Beutler Lab
Gene Symbol Prkag3
Ensembl Gene ENSMUSG00000006542
Gene Nameprotein kinase, AMP-activated, gamma 3 non-catalytic subunit
SynonymsAMPKg3L, AMPKg3, AMPKg3S
MMRRC Submission 038739-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R0547 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location74738922-74749221 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 74744720 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081636] [ENSMUST00000113672] [ENSMUST00000159728] [ENSMUST00000160732] [ENSMUST00000162093] [ENSMUST00000188073]
Predicted Effect probably null
Transcript: ENSMUST00000081636
SMART Domains Protein: ENSMUSP00000080342
Gene: ENSMUSG00000006542

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
CBS 283 332 7.57e-11 SMART
CBS 358 406 8.69e-11 SMART
CBS 430 478 3.73e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113672
SMART Domains Protein: ENSMUSP00000109302
Gene: ENSMUSG00000006542

DomainStartEndE-ValueType
low complexity region 38 52 N/A INTRINSIC
CBS 177 226 2.66e-6 SMART
CBS 258 307 7.57e-11 SMART
CBS 333 381 8.69e-11 SMART
CBS 405 453 3.73e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159728
Predicted Effect probably benign
Transcript: ENSMUST00000160732
SMART Domains Protein: ENSMUSP00000125344
Gene: ENSMUSG00000006542

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
CBS 283 332 7.57e-11 SMART
CBS 358 406 8.69e-11 SMART
CBS 430 478 3.73e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162093
SMART Domains Protein: ENSMUSP00000125242
Gene: ENSMUSG00000006542

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000188073
SMART Domains Protein: ENSMUSP00000139909
Gene: ENSMUSG00000006542

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
CBS 283 332 7.57e-11 SMART
CBS 358 406 8.69e-11 SMART
CBS 430 478 3.73e-10 SMART
Meta Mutation Damage Score 0.642 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a regulatory subunit of the AMP-activated protein kinase (AMPK). AMPK is a heterotrimer consisting of an alpha catalytic subunit, and non-catalytic beta and gamma subunits. AMPK is an important energy-sensing enzyme that monitors cellular energy status. In response to cellular metabolic stresses, AMPK is activated, and thus phosphorylates and inactivates acetyl-CoA carboxylase (ACC) and beta-hydroxy beta-methylglutaryl-CoA reductase (HMGCR), key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. This subunit is one of the gamma regulatory subunits of AMPK. It is dominantly expressed in skeletal muscle. Studies of the pig counterpart suggest that this subunit may play a key role in the regulation of energy metabolism in skeletal muscle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display impaired glycogen synthesis after exercise. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057N15Rik A G 16: 88,773,610 Y181H probably benign Het
A530084C06Rik A G 13: 31,558,830 probably benign Het
Adamtsl1 A G 4: 86,356,355 D1208G probably benign Het
Ankrd55 T C 13: 112,368,223 F501S probably benign Het
Aox2 G A 1: 58,310,042 D656N probably damaging Het
Atr A T 9: 95,899,165 probably benign Het
Bicra G A 7: 15,972,248 R1423W probably damaging Het
Cabyr T A 18: 12,751,016 S187T probably benign Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Cdon A T 9: 35,457,498 T343S possibly damaging Het
Cep350 C T 1: 155,901,435 probably null Het
Copa T C 1: 172,121,687 probably benign Het
Cyp4f18 T C 8: 71,996,010 D265G probably benign Het
Dgkb T A 12: 38,604,158 C759S probably benign Het
Dnah6 T C 6: 73,044,774 M3470V probably benign Het
Eif4g2 T C 7: 111,078,293 N177S probably damaging Het
Etfb C T 7: 43,454,578 Q145* probably null Het
Flnb T A 14: 7,912,943 probably null Het
G430095P16Rik G A 8: 84,726,642 probably benign Het
Gfral A T 9: 76,208,642 S17T probably benign Het
Gm884 T C 11: 103,620,164 N326S unknown Het
Gpr26 T C 7: 131,984,297 I332T probably benign Het
Greb1 T A 12: 16,723,411 T221S probably benign Het
Haus5 A T 7: 30,659,083 S289T probably damaging Het
Ighv6-4 T C 12: 114,406,601 Y77C probably damaging Het
Il23r A T 6: 67,423,701 D548E probably benign Het
Il23r A T 6: 67,486,251 F86Y possibly damaging Het
Inppl1 A T 7: 101,831,003 M424K probably benign Het
Jam3 A G 9: 27,098,888 Y267H probably damaging Het
Mms19 A T 19: 41,963,418 M160K probably damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Mup5 A G 4: 61,833,000 L137P probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Ntrk2 G A 13: 58,874,370 S413N probably damaging Het
Nuak2 C A 1: 132,332,203 T573N probably benign Het
Odf3 A G 7: 140,848,815 probably null Het
Olfr651 G A 7: 104,553,356 V146M probably benign Het
Olfr734 A T 14: 50,320,118 I239K probably benign Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pclo T A 5: 14,792,072 I4787N unknown Het
Pde8a G T 7: 81,324,130 V612L probably benign Het
Pear1 A T 3: 87,788,800 probably null Het
Pgbd1 A G 13: 21,423,518 Y169H probably damaging Het
Pkd1l1 A G 11: 8,836,448 probably benign Het
Rsph9 A T 17: 46,144,124 S9T possibly damaging Het
Rxfp1 A T 3: 79,705,569 probably null Het
Senp7 A G 16: 56,175,826 E756G probably damaging Het
Serpina1e G T 12: 103,949,191 T252K probably benign Het
Sipa1l1 T A 12: 82,437,736 S1555T probably benign Het
Slain1 T C 14: 103,695,275 S432P probably damaging Het
Slc37a2 A T 9: 37,233,122 probably null Het
Thg1l C T 11: 45,954,191 R18Q probably damaging Het
Tnn A G 1: 160,116,337 probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Tshz3 A G 7: 36,771,417 T944A probably damaging Het
Ttn C G 2: 76,854,430 probably benign Het
Ythdc2 T C 18: 44,840,264 S323P possibly damaging Het
Zfp827 A G 8: 79,060,310 N35S probably damaging Het
Other mutations in Prkag3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02085:Prkag3 APN 1 74748812 splice site probably benign
IGL02139:Prkag3 APN 1 74740724 missense probably benign 0.14
P0023:Prkag3 UTSW 1 74740739 missense probably damaging 1.00
R0002:Prkag3 UTSW 1 74744788 missense probably damaging 1.00
R0002:Prkag3 UTSW 1 74744788 missense probably damaging 1.00
R0256:Prkag3 UTSW 1 74741171 missense probably benign 0.01
R1314:Prkag3 UTSW 1 74747184 missense probably damaging 1.00
R1484:Prkag3 UTSW 1 74740760 missense probably damaging 1.00
R2842:Prkag3 UTSW 1 74741175 missense probably benign 0.30
R4739:Prkag3 UTSW 1 74740705 makesense probably null
R5159:Prkag3 UTSW 1 74741487 missense probably damaging 1.00
R5876:Prkag3 UTSW 1 74748816 critical splice donor site probably benign
R5989:Prkag3 UTSW 1 74741274 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAAAGATGTCCAGCGCAGTCAG -3'
(R):5'- TCAGATGGAGGGTTTCTACCACGG -3'

Sequencing Primer
(F):5'- AGGAGCTGTTTCCAGAACTAC -3'
(R):5'- GGGTTTCTACCACGGTGCTC -3'
Posted On2013-06-11