Incidental Mutation 'R5808:Ccdc162'
ID448845
Institutional Source Beutler Lab
Gene Symbol Ccdc162
Ensembl Gene ENSMUSG00000075225
Gene Namecoiled-coil domain containing 162
Synonyms5033413D22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R5808 (G1)
Quality Score220
Status Not validated
Chromosome10
Chromosomal Location41538846-41716634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41655504 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 502 (M502K)
Ref Sequence ENSEMBL: ENSMUSP00000150126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019955] [ENSMUST00000099932] [ENSMUST00000189488] [ENSMUST00000190522]
Predicted Effect probably benign
Transcript: ENSMUST00000019955
SMART Domains Protein: ENSMUSP00000019955
Gene: ENSMUSG00000075225

DomainStartEndE-ValueType
coiled coil region 1 37 N/A INTRINSIC
low complexity region 116 138 N/A INTRINSIC
coiled coil region 177 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099932
SMART Domains Protein: ENSMUSP00000097516
Gene: ENSMUSG00000075225

DomainStartEndE-ValueType
coiled coil region 327 366 N/A INTRINSIC
low complexity region 490 512 N/A INTRINSIC
coiled coil region 551 607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189488
AA Change: M502K

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000140774
Gene: ENSMUSG00000075225
AA Change: M502K

DomainStartEndE-ValueType
low complexity region 328 347 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000190522
AA Change: M502K

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140852
Gene: ENSMUSG00000100855
AA Change: M502K

DomainStartEndE-ValueType
Pfam:DUF4549 2 145 7.9e-74 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000190522
AA Change: M502K

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C T 10: 76,450,648 R6W probably damaging Het
9130019O22Rik A T 7: 127,384,913 probably benign Het
Ahnak T A 19: 9,010,235 V2961E possibly damaging Het
Aldh1a7 A T 19: 20,708,197 Y330N possibly damaging Het
Bag6 A G 17: 35,146,322 Y1041C probably damaging Het
Baz1b T A 5: 135,221,958 V866E probably benign Het
Bmpr2 A T 1: 59,867,401 Y551F probably benign Het
Cage1 A G 13: 38,022,325 probably benign Het
Caskin2 G T 11: 115,801,763 P732Q probably damaging Het
Cbfa2t2 T C 2: 154,517,826 probably null Het
Cfap157 T C 2: 32,780,645 D197G probably damaging Het
CN725425 T A 15: 91,245,644 S237T probably benign Het
Defb40 T C 8: 18,975,079 H37R probably benign Het
Dis3l2 A C 1: 87,049,638 S836R possibly damaging Het
Dnah14 T C 1: 181,741,159 I2818T possibly damaging Het
Dpysl2 T A 14: 66,865,172 probably null Het
Dsc1 A T 18: 20,086,829 C761* probably null Het
Dsg1b A T 18: 20,408,725 D763V probably damaging Het
Eif2ak1 C T 5: 143,883,994 P251L probably benign Het
Epha6 A T 16: 59,682,742 I934K probably damaging Het
Fbxo40 T C 16: 36,970,382 E122G probably damaging Het
Filip1 C T 9: 79,818,701 G879R possibly damaging Het
Frem2 A T 3: 53,652,563 F1508I probably damaging Het
Gja1 A G 10: 56,388,498 N318D probably benign Het
Gm11564 T C 11: 99,815,041 S188G unknown Het
Hlcs A G 16: 94,262,632 V523A probably benign Het
Kif1a C A 1: 93,042,698 E1041D probably damaging Het
Lamtor1 A G 7: 101,910,082 Y81C possibly damaging Het
Loxl1 A G 9: 58,294,449 L453S probably damaging Het
Mcf2l A G 8: 12,993,937 M1V probably null Het
Megf6 A G 4: 154,267,662 Q1208R probably benign Het
Morc2a T A 11: 3,683,781 I631N probably benign Het
Muc6 T C 7: 141,640,093 probably benign Het
Mybpc1 T C 10: 88,570,566 S139G possibly damaging Het
Myo18a T C 11: 77,829,301 F1017L probably benign Het
Nup62 A C 7: 44,829,992 Q477P possibly damaging Het
P2ry13 T A 3: 59,210,232 I42F probably benign Het
Ptprb G A 10: 116,339,487 R1129K probably benign Het
Rexo4 T A 2: 26,964,185 K45I probably damaging Het
Rnf213 G A 11: 119,436,295 V1703I probably benign Het
Sec23ip C A 7: 128,772,184 A710E probably benign Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc41a2 T C 10: 83,313,498 T194A probably benign Het
Slc4a10 G A 2: 62,250,472 A348T probably damaging Het
Soat2 G A 15: 102,154,025 probably null Het
Srms T C 2: 181,208,755 S204G probably benign Het
Szt2 G A 4: 118,372,613 R2774C unknown Het
Tcf7l2 T C 19: 55,908,541 V182A probably damaging Het
Tmem167b C T 3: 108,560,243 R29H probably benign Het
Trappc12 T A 12: 28,746,864 D223V probably damaging Het
Ttc6 T A 12: 57,617,611 S383R possibly damaging Het
Ubr1 C T 2: 120,961,092 R137H possibly damaging Het
Vmn2r24 T A 6: 123,815,638 C641* probably null Het
Vrk3 A G 7: 44,759,874 D155G probably damaging Het
Xxylt1 T C 16: 31,050,685 Y199C probably damaging Het
Zbtb46 A T 2: 181,423,570 D262E probably benign Het
Zcchc9 A T 13: 91,800,647 S58T probably benign Het
Zfyve16 A T 13: 92,495,055 L1344* probably null Het
Other mutations in Ccdc162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Ccdc162 APN 10 41581339 missense probably benign 0.01
IGL01366:Ccdc162 APN 10 41580306 missense possibly damaging 0.49
IGL01924:Ccdc162 APN 10 41569887 missense probably damaging 1.00
IGL02504:Ccdc162 APN 10 41552388 missense probably damaging 1.00
IGL02678:Ccdc162 APN 10 41561155 missense probably damaging 0.99
IGL02955:Ccdc162 APN 10 41561127 missense probably damaging 1.00
beeswax UTSW 10 41561226 missense possibly damaging 0.57
honeycomb UTSW 10 41644641 missense probably benign 0.35
FR4304:Ccdc162 UTSW 10 41556121 missense possibly damaging 0.49
R0432:Ccdc162 UTSW 10 41541860 missense probably benign 0.01
R0585:Ccdc162 UTSW 10 41586379 missense probably benign 0.03
R0645:Ccdc162 UTSW 10 41586411 splice site probably benign
R0731:Ccdc162 UTSW 10 41579143 missense probably damaging 1.00
R1426:Ccdc162 UTSW 10 41553182 missense possibly damaging 0.89
R1447:Ccdc162 UTSW 10 41580247 missense probably damaging 1.00
R1712:Ccdc162 UTSW 10 41539431 missense probably benign 0.35
R2138:Ccdc162 UTSW 10 41581297 missense probably benign 0.15
R2351:Ccdc162 UTSW 10 41555972 critical splice donor site probably null
R2394:Ccdc162 UTSW 10 41569898 missense probably damaging 1.00
R2431:Ccdc162 UTSW 10 41569845 missense probably benign
R2571:Ccdc162 UTSW 10 41552397 missense probably damaging 1.00
R2873:Ccdc162 UTSW 10 41655099 missense possibly damaging 0.68
R2926:Ccdc162 UTSW 10 41561207 start gained probably benign
R2999:Ccdc162 UTSW 10 41580290 missense probably benign 0.00
R3412:Ccdc162 UTSW 10 41539549 splice site probably benign
R3712:Ccdc162 UTSW 10 41587379 missense probably benign
R3736:Ccdc162 UTSW 10 41589568 intron probably null
R4112:Ccdc162 UTSW 10 41656328 missense possibly damaging 0.77
R4557:Ccdc162 UTSW 10 41587388 missense probably benign 0.01
R4580:Ccdc162 UTSW 10 41561140 missense probably benign 0.02
R4685:Ccdc162 UTSW 10 41681686 missense possibly damaging 0.89
R4837:Ccdc162 UTSW 10 41673867 missense probably benign 0.00
R5155:Ccdc162 UTSW 10 41553580 splice site probably null
R5155:Ccdc162 UTSW 10 41579151 missense probably damaging 1.00
R5645:Ccdc162 UTSW 10 41552356 missense probably benign 0.06
R5656:Ccdc162 UTSW 10 41569934 missense probably benign 0.26
R5682:Ccdc162 UTSW 10 41556803 nonsense probably null
R5909:Ccdc162 UTSW 10 41561115 missense probably damaging 1.00
R6000:Ccdc162 UTSW 10 41561163 missense possibly damaging 0.75
R6057:Ccdc162 UTSW 10 41634041 missense possibly damaging 0.72
R6211:Ccdc162 UTSW 10 41630145 nonsense probably null
R6264:Ccdc162 UTSW 10 41694468 missense probably benign 0.31
R6329:Ccdc162 UTSW 10 41663151 missense possibly damaging 0.76
R6349:Ccdc162 UTSW 10 41694400 missense probably damaging 0.97
R6398:Ccdc162 UTSW 10 41627149 missense probably damaging 1.00
R6453:Ccdc162 UTSW 10 41550825 missense probably damaging 1.00
R6602:Ccdc162 UTSW 10 41615980 missense probably benign 0.00
R6627:Ccdc162 UTSW 10 41663185 missense probably damaging 1.00
R6722:Ccdc162 UTSW 10 41644641 missense probably benign 0.35
R6750:Ccdc162 UTSW 10 41561226 missense possibly damaging 0.57
R6968:Ccdc162 UTSW 10 41673844 missense possibly damaging 0.55
R6970:Ccdc162 UTSW 10 41615958 missense probably benign 0.03
R6989:Ccdc162 UTSW 10 41581353 missense probably damaging 0.99
R7008:Ccdc162 UTSW 10 41552415 missense probably damaging 1.00
R7135:Ccdc162 UTSW 10 41673859 missense probably benign 0.00
R7139:Ccdc162 UTSW 10 41666721 missense possibly damaging 0.49
R7224:Ccdc162 UTSW 10 41561191 missense probably damaging 1.00
R7230:Ccdc162 UTSW 10 41678813 missense probably damaging 1.00
R7256:Ccdc162 UTSW 10 41556001 missense probably damaging 0.99
R7261:Ccdc162 UTSW 10 41561140 missense probably benign 0.02
R7390:Ccdc162 UTSW 10 41634048 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTACTGTGGACAAAGGAAGGC -3'
(R):5'- CCTTCCGTTCAGTGTCACAG -3'

Sequencing Primer
(F):5'- CCTGGAAGGGACTGATTACACAC -3'
(R):5'- TTCAGTGTCACAGCCCATGG -3'
Posted On2016-12-15