Incidental Mutation 'R0547:Trim32'
ID44891
Institutional Source Beutler Lab
Gene Symbol Trim32
Ensembl Gene ENSMUSG00000051675
Gene Nametripartite motif-containing 32
Synonyms1810045E12Rik, Zfp117, BBS11, 3f3
MMRRC Submission 038739-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.679) question?
Stock #R0547 (G1)
Quality Score182
Status Validated
Chromosome4
Chromosomal Location65604986-65616238 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 65613254 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 16 (R16Q)
Ref Sequence ENSEMBL: ENSMUSP00000119579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050850] [ENSMUST00000068214] [ENSMUST00000084496] [ENSMUST00000107366] [ENSMUST00000155978] [ENSMUST00000156922]
Predicted Effect probably damaging
Transcript: ENSMUST00000050850
AA Change: R16Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062277
Gene: ENSMUSG00000051675
AA Change: R16Q

DomainStartEndE-ValueType
RING 21 65 8.61e-9 SMART
BBOX 96 139 3.44e-8 SMART
low complexity region 253 268 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Pfam:NHL 471 498 6.9e-7 PFAM
Pfam:NHL 618 645 4.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068214
SMART Domains Protein: ENSMUSP00000065786
Gene: ENSMUSG00000028373

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 87 127 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
low complexity region 303 312 N/A INTRINSIC
low complexity region 342 361 N/A INTRINSIC
low complexity region 393 404 N/A INTRINSIC
low complexity region 432 437 N/A INTRINSIC
transmembrane domain 443 465 N/A INTRINSIC
EGF_like 526 563 2.92e1 SMART
Blast:EGF_like 667 708 2e-18 BLAST
EGF_like 715 764 4.03e1 SMART
MACPF 864 1048 2.88e-55 SMART
FN3 1079 1191 2.41e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084496
SMART Domains Protein: ENSMUSP00000081540
Gene: ENSMUSG00000028373

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 87 127 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
low complexity region 303 312 N/A INTRINSIC
low complexity region 341 352 N/A INTRINSIC
low complexity region 380 385 N/A INTRINSIC
transmembrane domain 391 413 N/A INTRINSIC
EGF_like 474 511 2.92e1 SMART
Blast:EGF_like 615 656 2e-18 BLAST
EGF_like 663 712 4.03e1 SMART
MACPF 812 996 2.88e-55 SMART
FN3 1027 1139 2.41e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107366
AA Change: R16Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102989
Gene: ENSMUSG00000051675
AA Change: R16Q

DomainStartEndE-ValueType
RING 21 65 8.61e-9 SMART
BBOX 96 139 3.44e-8 SMART
low complexity region 253 268 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Pfam:NHL 373 400 3.6e-7 PFAM
Pfam:NHL 471 498 2.7e-7 PFAM
Pfam:NHL 618 645 2.5e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155978
AA Change: R16Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119579
Gene: ENSMUSG00000051675
AA Change: R16Q

DomainStartEndE-ValueType
RING 21 65 8.61e-9 SMART
Blast:BBOX 96 136 3e-22 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000156922
AA Change: R16Q

PolyPhen 2 Score 0.517 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121949
Gene: ENSMUSG00000051675
AA Change: R16Q

DomainStartEndE-ValueType
RING 21 65 8.61e-9 SMART
BBOX 96 139 3.44e-8 SMART
Meta Mutation Damage Score 0.426 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. The protein has also been localized to the nucleus, where it interacts with the activation domain of the HIV-1 Tat protein. The Tat protein activates transcription of HIV-1 genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit mild myopathy with sarcotubular myopathy, decreased fertility, and decreased axon diameter. Mice homozygous for a knock-out allele exhibit impaired adult muscle regeneration and myopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057N15Rik A G 16: 88,773,610 Y181H probably benign Het
A530084C06Rik A G 13: 31,558,830 probably benign Het
Adamtsl1 A G 4: 86,356,355 D1208G probably benign Het
Ankrd55 T C 13: 112,368,223 F501S probably benign Het
Aox2 G A 1: 58,310,042 D656N probably damaging Het
Atr A T 9: 95,899,165 probably benign Het
Bicra G A 7: 15,972,248 R1423W probably damaging Het
Cabyr T A 18: 12,751,016 S187T probably benign Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Cdon A T 9: 35,457,498 T343S possibly damaging Het
Cep350 C T 1: 155,901,435 probably null Het
Copa T C 1: 172,121,687 probably benign Het
Cyp4f18 T C 8: 71,996,010 D265G probably benign Het
Dgkb T A 12: 38,604,158 C759S probably benign Het
Dnah6 T C 6: 73,044,774 M3470V probably benign Het
Eif4g2 T C 7: 111,078,293 N177S probably damaging Het
Etfb C T 7: 43,454,578 Q145* probably null Het
Flnb T A 14: 7,912,943 probably null Het
G430095P16Rik G A 8: 84,726,642 probably benign Het
Gfral A T 9: 76,208,642 S17T probably benign Het
Gm884 T C 11: 103,620,164 N326S unknown Het
Gpr26 T C 7: 131,984,297 I332T probably benign Het
Greb1 T A 12: 16,723,411 T221S probably benign Het
Haus5 A T 7: 30,659,083 S289T probably damaging Het
Ighv6-4 T C 12: 114,406,601 Y77C probably damaging Het
Il23r A T 6: 67,423,701 D548E probably benign Het
Il23r A T 6: 67,486,251 F86Y possibly damaging Het
Inppl1 A T 7: 101,831,003 M424K probably benign Het
Jam3 A G 9: 27,098,888 Y267H probably damaging Het
Mms19 A T 19: 41,963,418 M160K probably damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Mup5 A G 4: 61,833,000 L137P probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Ntrk2 G A 13: 58,874,370 S413N probably damaging Het
Nuak2 C A 1: 132,332,203 T573N probably benign Het
Odf3 A G 7: 140,848,815 probably null Het
Olfr651 G A 7: 104,553,356 V146M probably benign Het
Olfr734 A T 14: 50,320,118 I239K probably benign Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pclo T A 5: 14,792,072 I4787N unknown Het
Pde8a G T 7: 81,324,130 V612L probably benign Het
Pear1 A T 3: 87,788,800 probably null Het
Pgbd1 A G 13: 21,423,518 Y169H probably damaging Het
Pkd1l1 A G 11: 8,836,448 probably benign Het
Prkag3 C T 1: 74,744,720 probably null Het
Rsph9 A T 17: 46,144,124 S9T possibly damaging Het
Rxfp1 A T 3: 79,705,569 probably null Het
Senp7 A G 16: 56,175,826 E756G probably damaging Het
Serpina1e G T 12: 103,949,191 T252K probably benign Het
Sipa1l1 T A 12: 82,437,736 S1555T probably benign Het
Slain1 T C 14: 103,695,275 S432P probably damaging Het
Slc37a2 A T 9: 37,233,122 probably null Het
Thg1l C T 11: 45,954,191 R18Q probably damaging Het
Tnn A G 1: 160,116,337 probably benign Het
Tshz3 A G 7: 36,771,417 T944A probably damaging Het
Ttn C G 2: 76,854,430 probably benign Het
Ythdc2 T C 18: 44,840,264 S323P possibly damaging Het
Zfp827 A G 8: 79,060,310 N35S probably damaging Het
Other mutations in Trim32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02142:Trim32 APN 4 65614499 missense probably damaging 1.00
IGL02534:Trim32 APN 4 65614669 missense possibly damaging 0.72
R0302:Trim32 UTSW 4 65613254 missense probably damaging 1.00
R0356:Trim32 UTSW 4 65613254 missense probably damaging 1.00
R0358:Trim32 UTSW 4 65613254 missense probably damaging 1.00
R0497:Trim32 UTSW 4 65613254 missense probably damaging 1.00
R0544:Trim32 UTSW 4 65613254 missense probably damaging 1.00
R0611:Trim32 UTSW 4 65613656 missense possibly damaging 0.71
R1183:Trim32 UTSW 4 65614391 missense probably benign 0.00
R1523:Trim32 UTSW 4 65614004 missense probably benign 0.04
R1784:Trim32 UTSW 4 65614397 missense probably damaging 0.96
R1939:Trim32 UTSW 4 65614066 missense probably benign
R2069:Trim32 UTSW 4 65614776 nonsense probably null
R2869:Trim32 UTSW 4 65614457 missense probably damaging 1.00
R2869:Trim32 UTSW 4 65614457 missense probably damaging 1.00
R3875:Trim32 UTSW 4 65613466 missense possibly damaging 0.93
R5464:Trim32 UTSW 4 65614388 missense probably damaging 1.00
R6246:Trim32 UTSW 4 65614564 missense probably damaging 1.00
R6610:Trim32 UTSW 4 65615071 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCCTTACCCAGTTGTCAGGCTC -3'
(R):5'- ATCTTCAGCACCGTCAGGTTGTCG -3'

Sequencing Primer
(F):5'- gtgtgtatgtAAGGGGAGGG -3'
(R):5'- CCGTCAGGTTGTCGGTCAG -3'
Posted On2013-06-11