Incidental Mutation 'R4998:Gm10722'
ID448975
Institutional Source Beutler Lab
Gene Symbol Gm10722
Ensembl Gene ENSMUSG00000091028
Gene Namepredicted gene 10722
Synonyms
MMRRC Submission 042592-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.559) question?
Stock #R4998 (G1)
Quality Score22.1
Status Validated
Chromosome9
Chromosomal Location3000922-3002330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 3001041 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 39 (Y39S)
Ref Sequence ENSEMBL: ENSMUSP00000132394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151376] [ENSMUST00000177722] [ENSMUST00000178077] [ENSMUST00000178348] [ENSMUST00000179881]
Predicted Effect probably benign
Transcript: ENSMUST00000151376
AA Change: Y39S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132394
Gene: ENSMUSG00000091028
AA Change: Y39S

DomainStartEndE-ValueType
internal_repeat_2 8 50 1.25e-5 PROSPERO
internal_repeat_1 11 88 6.98e-39 PROSPERO
internal_repeat_2 66 108 1.25e-5 PROSPERO
internal_repeat_1 89 166 6.98e-39 PROSPERO
transmembrane domain 187 209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177722
SMART Domains Protein: ENSMUSP00000136598
Gene: ENSMUSG00000096385

DomainStartEndE-ValueType
internal_repeat_1 1 19 1.14e-8 PROSPERO
transmembrane domain 26 48 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
internal_repeat_1 118 136 1.14e-8 PROSPERO
transmembrane domain 156 178 N/A INTRINSIC
transmembrane domain 200 222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178077
SMART Domains Protein: ENSMUSP00000136761
Gene: ENSMUSG00000096385

DomainStartEndE-ValueType
internal_repeat_1 1 19 4.71e-8 PROSPERO
transmembrane domain 26 48 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
internal_repeat_1 118 136 4.71e-8 PROSPERO
transmembrane domain 156 178 N/A INTRINSIC
transmembrane domain 200 222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178348
SMART Domains Protein: ENSMUSP00000137273
Gene: ENSMUSG00000096385

DomainStartEndE-ValueType
internal_repeat_1 1 48 1.34e-9 PROSPERO
transmembrane domain 77 99 N/A INTRINSIC
internal_repeat_1 117 165 1.34e-9 PROSPERO
transmembrane domain 196 218 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179881
SMART Domains Protein: ENSMUSP00000136541
Gene: ENSMUSG00000096385

DomainStartEndE-ValueType
internal_repeat_1 1 46 5.29e-7 PROSPERO
transmembrane domain 53 72 N/A INTRINSIC
transmembrane domain 77 99 N/A INTRINSIC
internal_repeat_1 117 182 5.29e-7 PROSPERO
transmembrane domain 195 217 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181242
Meta Mutation Damage Score 0.1984 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 97% (91/94)
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T C 7: 27,571,663 V135A probably damaging Het
Ankrd42 T C 7: 92,624,074 N115S possibly damaging Het
Baz1a T C 12: 54,975,137 E120G probably damaging Het
Calcrl A T 2: 84,339,314 V341E probably damaging Het
Card6 T C 15: 5,100,082 R611G probably benign Het
Cd70 A T 17: 57,146,311 S118T probably damaging Het
Chil5 T A 3: 106,019,932 I188F probably damaging Het
Clca4b C T 3: 144,915,508 V602I probably benign Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Col6a4 A G 9: 105,990,778 probably benign Het
Cox8b T C 7: 140,899,088 E38G probably damaging Het
Cx3cl1 C G 8: 94,780,425 L353V probably damaging Het
Cyp2a4 G T 7: 26,307,361 Q48H probably damaging Het
Defb8 T C 8: 19,447,587 I3V probably benign Het
Dip2a A T 10: 76,319,556 L65* probably null Het
Dsg2 A T 18: 20,601,521 D852V probably benign Het
Dyx1c1 A G 9: 72,960,678 T74A possibly damaging Het
Edar T C 10: 58,606,093 R326G probably damaging Het
Egfr A G 11: 16,881,493 E554G possibly damaging Het
Eif2b3 A C 4: 117,066,392 K268T probably benign Het
Enox1 A T 14: 77,501,435 probably benign Het
Enpp3 C A 10: 24,807,538 M260I probably benign Het
Espn A T 4: 152,135,583 M361K possibly damaging Het
Fam107a T C 14: 8,299,514 N108S possibly damaging Het
Fam57b C T 7: 126,827,623 R73C probably damaging Het
Fbn2 A T 18: 58,072,631 V1125D probably damaging Het
Fbxo30 T A 10: 11,290,763 S410T probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fuk G A 8: 110,887,803 A618V probably damaging Het
Gm10715 T G 9: 3,038,073 probably benign Het
Gm17416 C A 2: 152,569,507 P57Q probably damaging Het
Gm27013 A T 6: 130,676,538 C654S probably damaging Het
Gm9495 G C 8: 69,453,358 N13K probably benign Het
Gon4l G T 3: 88,899,998 E1666D probably damaging Het
Gypa T A 8: 80,496,335 S23T unknown Het
Gys1 C A 7: 45,451,544 probably benign Het
Hdac10 T A 15: 89,123,940 Q569L possibly damaging Het
Icos A G 1: 60,993,782 T47A possibly damaging Het
Igfn1 T A 1: 135,954,666 I2814F probably damaging Het
Kif27 A G 13: 58,293,143 S1153P probably damaging Het
Lin28a A C 4: 134,018,717 F9V possibly damaging Het
Lrriq3 T A 3: 155,188,058 N465K probably benign Het
Lsm14a T C 7: 34,375,374 E47G probably damaging Het
Mmel1 A G 4: 154,885,510 K177R probably benign Het
Ncstn T A 1: 172,071,520 N348I possibly damaging Het
Ninl A G 2: 150,953,364 I619T probably damaging Het
Npb T C 11: 120,608,575 Y23H probably damaging Het
Npepps A G 11: 97,206,107 probably benign Het
Olfr1076 T C 2: 86,509,355 Y299H probably benign Het
Otop1 G A 5: 38,294,548 probably null Het
Pcdha1 T C 18: 36,932,416 L711P probably damaging Het
Pcyt1a A G 16: 32,451,842 probably benign Het
Pdpr G T 8: 111,114,768 V211F probably damaging Het
Pip4k2b T C 11: 97,722,435 N245S possibly damaging Het
Platr26 G A 2: 71,730,870 noncoding transcript Het
Plek A G 11: 16,983,194 probably null Het
Prdm15 A T 16: 97,794,489 D1046E probably damaging Het
Prr29 T G 11: 106,376,953 C175G probably benign Het
Ptpru A G 4: 131,776,885 V1097A probably damaging Het
Ramp2 T A 11: 101,247,421 probably benign Het
Rap1gap A G 4: 137,728,284 D381G possibly damaging Het
Rbbp6 T A 7: 122,990,326 D412E probably benign Het
Rgs4 C T 1: 169,745,233 V45I probably benign Het
Ryr2 C T 13: 11,643,895 R3614Q probably damaging Het
Shc3 G A 13: 51,442,820 probably null Het
Shmt2 A T 10: 127,518,270 C412S probably damaging Het
Slc25a45 A T 19: 5,884,917 N265Y probably damaging Het
Slc4a10 G C 2: 62,244,439 E316Q probably benign Het
Slc5a8 T C 10: 88,908,057 probably null Het
Snx31 A G 15: 36,539,367 V121A probably damaging Het
Socs3 T C 11: 117,967,716 E172G probably damaging Het
Tg A G 15: 66,674,050 D207G probably damaging Het
Them4 G T 3: 94,329,781 V183F probably damaging Het
Tkt G A 14: 30,565,542 W136* probably null Het
Tmc3 C A 7: 83,622,321 R894S probably benign Het
Tmem132a G T 19: 10,858,941 P742T probably benign Het
Tmem202 A G 9: 59,524,846 L66P probably damaging Het
Trbc1 G A 6: 41,539,336 probably benign Het
Trhr2 A G 8: 122,358,772 F158L probably benign Het
Ttc13 A T 8: 124,680,056 N595K probably damaging Het
Ucp1 A G 8: 83,297,855 probably null Het
Zbtb4 C T 11: 69,778,671 T740I probably benign Het
Zfp69 A T 4: 120,947,325 D116E possibly damaging Het
Zfp879 A G 11: 50,837,969 L66S probably damaging Het
Zfp955b T A 17: 33,305,151 probably benign Het
Zfyve1 T C 12: 83,548,065 I718V possibly damaging Het
Other mutations in Gm10722
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Gm10722 APN 9 3002230 missense probably damaging 0.98
PIT4131001:Gm10722 UTSW 9 3001414 unclassified probably benign
PIT4142001:Gm10722 UTSW 9 3001350 missense probably benign
R0148:Gm10722 UTSW 9 3001405 missense probably null
R0335:Gm10722 UTSW 9 3001048 missense probably null
R4162:Gm10722 UTSW 9 3001041 missense probably benign
R4327:Gm10722 UTSW 9 3000937 missense probably benign
R4449:Gm10722 UTSW 9 3001041 missense probably benign
R4516:Gm10722 UTSW 9 3000937 missense probably benign
R4807:Gm10722 UTSW 9 3000937 missense probably benign
R5017:Gm10722 UTSW 9 3000937 missense probably benign
R5021:Gm10722 UTSW 9 3001041 missense probably benign
R5075:Gm10722 UTSW 9 3001041 missense probably benign
R5135:Gm10722 UTSW 9 3000937 missense probably benign
R5152:Gm10722 UTSW 9 3001041 missense probably benign
R5226:Gm10722 UTSW 9 3000937 missense probably benign
R5482:Gm10722 UTSW 9 3001041 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCGTCAACTGTATGTTTCTCATTTT -3'
(R):5'- GCACACTGTAGGACCTGGAATAT -3'

Sequencing Primer
(F):5'- GCCATATTTCAGGTCCTACAGTGTG -3'
(R):5'- CACACTTTAGGACATGAAATATGGCG -3'
Posted On2016-12-20