Mutagenetix > Incidental Mutation

Incidental Mutation 'R5815:Reln'

448989

Institutional Source

Beutler Lab

Gene Symbol

Reln

Ensembl Gene

ENSMUSG00000042453

Gene Name

reelin

Synonyms

Accession Numbers

Essential gene?

Probably essential (E-score: 0.951) question?

Stock #

R5815 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

22089452-22549700 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 22152431 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 2345 (M2345T)

Ref Sequence

ENSEMBL: ENSMUSP00000124052 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000062372
AA Change: M2345T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: M2345T

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	40	172	6.1e-24	PFAM
internal_repeat_3	195	360	5.04e-6	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3450	3457	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000084713

Predicted Effect

probably damaging
Transcript: ENSMUST00000161356
AA Change: M2345T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: M2345T

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	54	171	2.9e-10	PFAM
internal_repeat_3	195	360	5.06e-6	PROSPERO
internal_repeat_2	207	413	3.41e-11	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
internal_repeat_2	1452	1660	3.41e-11	PROSPERO
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3452	3459	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162103

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afmid	A	G	11: 117,726,530 (GRCm39)	D226G	probably benign	Het
Ago2	T	C	15: 72,979,215 (GRCm39)		probably null	Het
Aldh1a1	C	A	19: 20,608,034 (GRCm39)	D285E	probably benign	Het
Alms1	T	C	6: 85,599,820 (GRCm39)	S1549P	probably damaging	Het
Apmap	T	C	2: 150,442,171 (GRCm39)	S68G	probably benign	Het
Atp8a1	A	T	5: 67,906,414 (GRCm39)	I500N	probably benign	Het
B3gnt7	A	C	1: 86,233,510 (GRCm39)	D135A	probably benign	Het
Bms1	A	T	6: 118,381,240 (GRCm39)	L692H	probably damaging	Het
Cdk17	T	A	10: 93,064,559 (GRCm39)	V276E	probably damaging	Het
Cep290	A	T	10: 100,393,970 (GRCm39)	E2059V	possibly damaging	Het
Cpxm2	C	A	7: 131,645,839 (GRCm39)	G693V	probably damaging	Het
Crocc	A	T	4: 140,762,507 (GRCm39)	V661E	probably damaging	Het
D1Pas1	A	T	1: 186,700,206 (GRCm39)	N45I	probably damaging	Het
Ddx19a	C	T	8: 111,705,781 (GRCm39)	W223*	probably null	Het
Ddx60	C	A	8: 62,416,756 (GRCm39)	S567Y	probably damaging	Het
Dhx36	A	T	3: 62,401,176 (GRCm39)	N363K	probably damaging	Het
Gm57859	C	A	11: 113,578,783 (GRCm39)		probably null	Het
Gpr151	G	A	18: 42,712,450 (GRCm39)	T76M	probably benign	Het
Inhbc	C	T	10: 127,193,318 (GRCm39)	V233I	probably benign	Het
Ippk	C	T	13: 49,599,839 (GRCm39)	L233F	probably damaging	Het
Lama2	A	G	10: 26,862,847 (GRCm39)	V2972A	probably damaging	Het
Lrrc37a	T	C	11: 103,394,612 (GRCm39)	Q271R	probably benign	Het
Mia2	A	T	12: 59,220,892 (GRCm39)	K1083N	possibly damaging	Het
Mphosph9	A	C	5: 124,453,481 (GRCm39)	L277R	probably damaging	Het
Myo7b	A	T	18: 32,099,341 (GRCm39)	F1694I	probably damaging	Het
Obscn	T	C	11: 58,973,015 (GRCm39)		probably null	Het
Or1e16	AGCGGTCGTAGGC	AGC	11: 73,286,480 (GRCm39)		probably null	Het
Or2w6	T	C	13: 21,842,707 (GRCm39)	Y262C	probably damaging	Het
Pcdh10	A	G	3: 45,347,156 (GRCm39)	T984A	probably benign	Het
Pcdh20	T	C	14: 88,708,312 (GRCm39)	S39G	probably benign	Het
Pdia3	T	A	2: 121,266,892 (GRCm39)	Y467*	probably null	Het
Ptpn13	C	A	5: 103,745,556 (GRCm39)		probably null	Het
Rnf126	A	T	10: 79,602,603 (GRCm39)	I20N	probably benign	Het
Satb1	A	G	17: 52,089,981 (GRCm39)	S289P	possibly damaging	Het
Scd4	A	T	19: 44,326,003 (GRCm39)	H119L	probably damaging	Het
Sco2	T	C	15: 89,256,574 (GRCm39)	T27A	probably benign	Het
Slc39a14	A	T	14: 70,544,194 (GRCm39)	I464N	probably damaging	Het
Slc4a8	T	A	15: 100,686,092 (GRCm39)	V220E	probably benign	Het
Themis3	C	T	17: 66,862,699 (GRCm39)	V420I	possibly damaging	Het
Tmf1	T	A	6: 97,150,364 (GRCm39)	T448S	probably benign	Het
Tspan33	G	A	6: 29,710,688 (GRCm39)	R87Q	probably damaging	Het
Vmn2r91	A	T	17: 18,326,464 (GRCm39)	M250L	probably benign	Het
Zc3h7a	A	T	16: 10,974,050 (GRCm39)	V245D	probably damaging	Het

Other mutations in Reln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Reln	APN	5	22,244,563 (GRCm39)	missense	possibly damaging	0.57
IGL00091:Reln	APN	5	22,244,563 (GRCm39)	missense	possibly damaging	0.57
IGL00432:Reln	APN	5	22,215,125 (GRCm39)	missense	probably damaging	1.00
IGL00433:Reln	APN	5	22,250,007 (GRCm39)	missense	probably damaging	1.00
IGL00576:Reln	APN	5	22,359,948 (GRCm39)	missense	probably benign	0.01
IGL00755:Reln	APN	5	22,265,378 (GRCm39)	missense	probably damaging	0.98
IGL00777:Reln	APN	5	22,223,848 (GRCm39)	critical splice donor site	probably null
IGL00900:Reln	APN	5	22,185,115 (GRCm39)	missense	probably damaging	0.98
IGL01067:Reln	APN	5	22,184,664 (GRCm39)	missense	probably damaging	1.00
IGL01104:Reln	APN	5	22,191,965 (GRCm39)	missense	probably damaging	0.99
IGL01141:Reln	APN	5	22,174,031 (GRCm39)	missense	probably damaging	1.00
IGL01141:Reln	APN	5	22,124,067 (GRCm39)	missense	probably damaging	1.00
IGL01333:Reln	APN	5	22,376,249 (GRCm39)	missense	probably damaging	0.99
IGL01341:Reln	APN	5	22,174,077 (GRCm39)	missense	probably damaging	1.00
IGL01354:Reln	APN	5	22,124,173 (GRCm39)	nonsense	probably null
IGL01361:Reln	APN	5	22,124,019 (GRCm39)	missense	probably benign	0.06
IGL01446:Reln	APN	5	22,174,315 (GRCm39)	missense	probably damaging	0.99
IGL01448:Reln	APN	5	22,245,403 (GRCm39)	missense	probably benign	0.40
IGL01612:Reln	APN	5	22,101,928 (GRCm39)	missense	probably damaging	0.99
IGL01695:Reln	APN	5	22,125,436 (GRCm39)	missense	probably damaging	1.00
IGL01718:Reln	APN	5	22,152,512 (GRCm39)	missense	possibly damaging	0.60
IGL01749:Reln	APN	5	22,549,244 (GRCm39)	nonsense	probably null
IGL01875:Reln	APN	5	22,109,715 (GRCm39)	missense	probably benign
IGL02013:Reln	APN	5	22,155,877 (GRCm39)	missense	probably damaging	1.00
IGL02031:Reln	APN	5	22,184,014 (GRCm39)	missense	probably damaging	0.99
IGL02186:Reln	APN	5	22,114,956 (GRCm39)	missense	probably damaging	1.00
IGL02228:Reln	APN	5	22,109,729 (GRCm39)	missense	probably damaging	0.99
IGL02248:Reln	APN	5	22,115,990 (GRCm39)	missense	probably damaging	1.00
IGL02336:Reln	APN	5	22,134,132 (GRCm39)	missense	probably damaging	1.00
IGL02352:Reln	APN	5	22,244,563 (GRCm39)	missense	possibly damaging	0.57
IGL02359:Reln	APN	5	22,244,563 (GRCm39)	missense	possibly damaging	0.57
IGL02376:Reln	APN	5	22,285,789 (GRCm39)	nonsense	probably null
IGL02408:Reln	APN	5	22,106,617 (GRCm39)	missense	probably benign	0.44
IGL02415:Reln	APN	5	22,176,949 (GRCm39)	missense	possibly damaging	0.91
IGL02512:Reln	APN	5	22,245,425 (GRCm39)	missense	probably benign	0.00
IGL02540:Reln	APN	5	22,239,750 (GRCm39)	missense	probably damaging	0.96
IGL02624:Reln	APN	5	22,308,355 (GRCm39)	missense	probably benign	0.09
IGL02720:Reln	APN	5	22,202,939 (GRCm39)	missense	probably damaging	0.99
IGL02894:Reln	APN	5	22,090,546 (GRCm39)	missense	possibly damaging	0.72
IGL02999:Reln	APN	5	22,200,363 (GRCm39)	missense	probably damaging	1.00
IGL03125:Reln	APN	5	22,115,842 (GRCm39)	missense	probably damaging	1.00
IGL03298:Reln	APN	5	22,115,834 (GRCm39)	missense	probably damaging	0.99
Fishing	UTSW	5	22,101,839 (GRCm39)	missense	probably damaging	1.00
P0020:Reln	UTSW	5	22,311,058 (GRCm39)	missense	possibly damaging	0.91
PIT4151001:Reln	UTSW	5	22,491,894 (GRCm39)	missense	possibly damaging	0.71
R0018:Reln	UTSW	5	22,130,369 (GRCm39)	missense	probably benign	0.01
R0105:Reln	UTSW	5	22,253,813 (GRCm39)	missense	probably damaging	0.99
R0105:Reln	UTSW	5	22,253,813 (GRCm39)	missense	probably damaging	0.99
R0127:Reln	UTSW	5	22,209,134 (GRCm39)	missense	probably damaging	1.00
R0135:Reln	UTSW	5	22,333,647 (GRCm39)	missense	probably damaging	0.99
R0144:Reln	UTSW	5	22,153,447 (GRCm39)	missense	probably damaging	0.97
R0240:Reln	UTSW	5	22,311,043 (GRCm39)	missense	probably benign	0.36
R0240:Reln	UTSW	5	22,311,043 (GRCm39)	missense	probably benign	0.36
R0242:Reln	UTSW	5	22,147,595 (GRCm39)	critical splice donor site	probably null
R0242:Reln	UTSW	5	22,147,595 (GRCm39)	critical splice donor site	probably null
R0266:Reln	UTSW	5	22,193,774 (GRCm39)	missense	probably damaging	1.00
R0269:Reln	UTSW	5	22,125,535 (GRCm39)	missense	probably damaging	1.00
R0280:Reln	UTSW	5	22,432,511 (GRCm39)	splice site	probably benign
R0333:Reln	UTSW	5	22,134,240 (GRCm39)	missense	probably damaging	0.97
R0357:Reln	UTSW	5	22,155,820 (GRCm39)	missense	probably damaging	1.00
R0359:Reln	UTSW	5	22,253,798 (GRCm39)	missense	probably damaging	0.98
R0506:Reln	UTSW	5	22,125,494 (GRCm39)	missense	probably damaging	0.97
R0534:Reln	UTSW	5	22,152,406 (GRCm39)	missense	probably damaging	0.99
R0535:Reln	UTSW	5	22,256,274 (GRCm39)	splice site	probably benign
R0541:Reln	UTSW	5	22,185,107 (GRCm39)	missense	possibly damaging	0.88
R0615:Reln	UTSW	5	22,215,148 (GRCm39)	missense	probably benign	0.36
R0617:Reln	UTSW	5	22,125,535 (GRCm39)	missense	probably damaging	1.00
R0634:Reln	UTSW	5	22,223,867 (GRCm39)	missense	probably damaging	1.00
R0653:Reln	UTSW	5	22,118,228 (GRCm39)	missense	probably benign	0.44
R0704:Reln	UTSW	5	22,101,809 (GRCm39)	missense	probably damaging	0.99
R0706:Reln	UTSW	5	22,101,809 (GRCm39)	missense	probably damaging	0.99
R0959:Reln	UTSW	5	22,432,626 (GRCm39)	missense	probably damaging	0.96
R1066:Reln	UTSW	5	22,239,662 (GRCm39)	missense	probably damaging	1.00
R1110:Reln	UTSW	5	22,239,773 (GRCm39)	missense	probably benign
R1163:Reln	UTSW	5	22,104,027 (GRCm39)	missense	probably benign	0.03
R1222:Reln	UTSW	5	22,191,953 (GRCm39)	missense	probably null	0.97
R1226:Reln	UTSW	5	22,115,864 (GRCm39)	missense	probably damaging	1.00
R1440:Reln	UTSW	5	22,333,600 (GRCm39)	splice site	probably benign
R1532:Reln	UTSW	5	22,239,742 (GRCm39)	missense	probably damaging	0.99
R1552:Reln	UTSW	5	22,165,376 (GRCm39)	missense	probably benign	0.01
R1565:Reln	UTSW	5	22,130,211 (GRCm39)	missense	probably benign	0.05
R1618:Reln	UTSW	5	22,265,366 (GRCm39)	missense	probably benign	0.01
R1636:Reln	UTSW	5	22,203,681 (GRCm39)	missense	probably damaging	0.99
R1664:Reln	UTSW	5	22,134,084 (GRCm39)	missense	probably damaging	1.00
R1716:Reln	UTSW	5	22,160,093 (GRCm39)	missense	probably damaging	0.98
R1759:Reln	UTSW	5	22,215,287 (GRCm39)	missense	probably damaging	0.99
R1835:Reln	UTSW	5	22,184,000 (GRCm39)	missense	probably damaging	1.00
R1907:Reln	UTSW	5	22,249,960 (GRCm39)	critical splice donor site	probably null
R1991:Reln	UTSW	5	22,174,358 (GRCm39)	missense	possibly damaging	0.56
R2046:Reln	UTSW	5	22,147,625 (GRCm39)	missense	probably benign	0.01
R2072:Reln	UTSW	5	22,124,175 (GRCm39)	missense	probably damaging	1.00
R2103:Reln	UTSW	5	22,174,358 (GRCm39)	missense	possibly damaging	0.56
R2119:Reln	UTSW	5	22,223,998 (GRCm39)	missense	probably damaging	1.00
R2120:Reln	UTSW	5	22,174,083 (GRCm39)	missense	probably damaging	1.00
R2216:Reln	UTSW	5	22,253,003 (GRCm39)	missense	probably benign	0.30
R2219:Reln	UTSW	5	22,177,045 (GRCm39)	missense	possibly damaging	0.88
R2228:Reln	UTSW	5	22,192,076 (GRCm39)	missense	possibly damaging	0.69
R2306:Reln	UTSW	5	22,101,784 (GRCm39)	missense	probably damaging	1.00
R2316:Reln	UTSW	5	22,359,954 (GRCm39)	missense	probably benign	0.00
R2321:Reln	UTSW	5	22,120,018 (GRCm39)	missense	probably damaging	0.99
R2512:Reln	UTSW	5	22,184,688 (GRCm39)	missense	possibly damaging	0.89
R2519:Reln	UTSW	5	22,549,367 (GRCm39)	missense	unknown
R2870:Reln	UTSW	5	22,254,789 (GRCm39)	missense	possibly damaging	0.95
R2870:Reln	UTSW	5	22,254,789 (GRCm39)	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22,254,789 (GRCm39)	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22,254,789 (GRCm39)	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22,254,789 (GRCm39)	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22,254,789 (GRCm39)	missense	possibly damaging	0.95
R3195:Reln	UTSW	5	22,245,418 (GRCm39)	missense	possibly damaging	0.72
R3545:Reln	UTSW	5	22,432,598 (GRCm39)	missense	possibly damaging	0.64
R3546:Reln	UTSW	5	22,432,598 (GRCm39)	missense	possibly damaging	0.64
R3547:Reln	UTSW	5	22,432,598 (GRCm39)	missense	possibly damaging	0.64
R3706:Reln	UTSW	5	22,200,587 (GRCm39)	splice site	probably benign
R3713:Reln	UTSW	5	22,109,732 (GRCm39)	missense	probably damaging	0.99
R3770:Reln	UTSW	5	22,153,564 (GRCm39)	missense	probably damaging	1.00
R3836:Reln	UTSW	5	22,116,012 (GRCm39)	missense	probably damaging	1.00
R3887:Reln	UTSW	5	22,115,847 (GRCm39)	missense	possibly damaging	0.92
R3972:Reln	UTSW	5	22,183,999 (GRCm39)	missense	probably damaging	0.99
R3975:Reln	UTSW	5	22,200,364 (GRCm39)	missense	possibly damaging	0.57
R4022:Reln	UTSW	5	22,432,628 (GRCm39)	missense	probably benign	0.45
R4044:Reln	UTSW	5	22,333,630 (GRCm39)	missense	possibly damaging	0.82
R4107:Reln	UTSW	5	22,239,582 (GRCm39)	missense	probably damaging	1.00
R4297:Reln	UTSW	5	22,125,485 (GRCm39)	missense	probably damaging	0.99
R4298:Reln	UTSW	5	22,125,485 (GRCm39)	missense	probably damaging	0.99
R4299:Reln	UTSW	5	22,125,485 (GRCm39)	missense	probably damaging	0.99
R4518:Reln	UTSW	5	22,106,741 (GRCm39)	missense	probably benign	0.44
R4615:Reln	UTSW	5	22,177,870 (GRCm39)	missense	possibly damaging	0.95
R4713:Reln	UTSW	5	22,357,461 (GRCm39)	missense	probably benign	0.17
R4720:Reln	UTSW	5	22,491,894 (GRCm39)	missense	possibly damaging	0.71
R4721:Reln	UTSW	5	22,124,220 (GRCm39)	missense	probably damaging	0.99
R4771:Reln	UTSW	5	22,254,698 (GRCm39)	missense	probably damaging	1.00
R4794:Reln	UTSW	5	22,549,183 (GRCm39)	missense	probably damaging	0.98
R4840:Reln	UTSW	5	22,223,844 (GRCm39)	splice site	probably null
R4860:Reln	UTSW	5	22,106,749 (GRCm39)	missense	probably benign	0.06
R4860:Reln	UTSW	5	22,106,749 (GRCm39)	missense	probably benign	0.06
R4896:Reln	UTSW	5	22,160,236 (GRCm39)	missense	probably damaging	1.00
R4908:Reln	UTSW	5	22,184,718 (GRCm39)	missense	probably benign	0.02
R4912:Reln	UTSW	5	22,130,191 (GRCm39)	missense	probably benign	0.29
R4922:Reln	UTSW	5	22,200,585 (GRCm39)	critical splice acceptor site	probably null
R4975:Reln	UTSW	5	22,165,424 (GRCm39)	missense	probably damaging	1.00
R4976:Reln	UTSW	5	22,176,868 (GRCm39)	missense	probably benign	0.05
R5020:Reln	UTSW	5	22,239,636 (GRCm39)	missense	probably damaging	1.00
R5037:Reln	UTSW	5	22,153,510 (GRCm39)	missense	probably damaging	1.00
R5082:Reln	UTSW	5	22,101,075 (GRCm39)	missense	probably benign	0.00
R5119:Reln	UTSW	5	22,176,868 (GRCm39)	missense	probably benign	0.05
R5125:Reln	UTSW	5	22,118,239 (GRCm39)	missense	possibly damaging	0.78
R5137:Reln	UTSW	5	22,160,179 (GRCm39)	missense	probably damaging	1.00
R5152:Reln	UTSW	5	22,153,627 (GRCm39)	missense	probably damaging	1.00
R5154:Reln	UTSW	5	22,193,763 (GRCm39)	missense	probably damaging	0.99
R5259:Reln	UTSW	5	22,308,395 (GRCm39)	missense	possibly damaging	0.83
R5283:Reln	UTSW	5	22,216,161 (GRCm39)	missense	probably damaging	1.00
R5386:Reln	UTSW	5	22,244,527 (GRCm39)	missense	probably benign
R5400:Reln	UTSW	5	22,184,712 (GRCm39)	missense	probably damaging	1.00
R5478:Reln	UTSW	5	22,209,201 (GRCm39)	missense	probably benign	0.00
R5514:Reln	UTSW	5	22,176,883 (GRCm39)	missense	possibly damaging	0.93
R5529:Reln	UTSW	5	22,137,713 (GRCm39)	missense	possibly damaging	0.71
R5611:Reln	UTSW	5	22,244,663 (GRCm39)	nonsense	probably null
R5648:Reln	UTSW	5	22,203,570 (GRCm39)	missense	probably benign	0.04
R5649:Reln	UTSW	5	22,106,623 (GRCm39)	missense	probably benign	0.33
R5744:Reln	UTSW	5	22,311,081 (GRCm39)	missense	probably null	0.39
R5782:Reln	UTSW	5	22,223,054 (GRCm39)	missense	probably benign	0.01
R5838:Reln	UTSW	5	22,104,111 (GRCm39)	missense	probably damaging	0.97
R6162:Reln	UTSW	5	22,116,048 (GRCm39)	missense	probably damaging	1.00
R6219:Reln	UTSW	5	22,153,594 (GRCm39)	missense	probably damaging	1.00
R6259:Reln	UTSW	5	22,265,331 (GRCm39)	missense	probably damaging	0.99
R6279:Reln	UTSW	5	22,101,839 (GRCm39)	missense	probably damaging	1.00
R6299:Reln	UTSW	5	22,491,942 (GRCm39)	missense	possibly damaging	0.71
R6300:Reln	UTSW	5	22,101,839 (GRCm39)	missense	probably damaging	1.00
R6314:Reln	UTSW	5	22,357,482 (GRCm39)	nonsense	probably null
R6351:Reln	UTSW	5	22,106,661 (GRCm39)	nonsense	probably null
R6369:Reln	UTSW	5	22,256,359 (GRCm39)	missense	probably benign	0.03
R6371:Reln	UTSW	5	22,200,511 (GRCm39)	missense	probably benign
R6374:Reln	UTSW	5	22,285,712 (GRCm39)	missense	probably benign	0.06
R6425:Reln	UTSW	5	22,116,018 (GRCm39)	nonsense	probably null
R6442:Reln	UTSW	5	22,137,774 (GRCm39)	missense	probably benign
R6445:Reln	UTSW	5	22,124,212 (GRCm39)	missense	probably benign	0.05
R6554:Reln	UTSW	5	22,101,838 (GRCm39)	missense	probably damaging	1.00
R6641:Reln	UTSW	5	22,134,132 (GRCm39)	missense	probably damaging	1.00
R6768:Reln	UTSW	5	22,183,905 (GRCm39)	missense	probably damaging	0.99
R6859:Reln	UTSW	5	22,239,568 (GRCm39)	missense	probably damaging	1.00
R6896:Reln	UTSW	5	22,104,177 (GRCm39)	missense	probably benign	0.18
R6932:Reln	UTSW	5	22,190,855 (GRCm39)	missense	probably benign	0.00
R6948:Reln	UTSW	5	22,177,033 (GRCm39)	missense	probably damaging	1.00
R6959:Reln	UTSW	5	22,181,562 (GRCm39)	missense	probably damaging	1.00
R7085:Reln	UTSW	5	22,120,085 (GRCm39)	nonsense	probably null
R7091:Reln	UTSW	5	22,104,027 (GRCm39)	missense	probably null	0.08
R7135:Reln	UTSW	5	22,181,594 (GRCm39)	missense	possibly damaging	0.95
R7146:Reln	UTSW	5	22,311,095 (GRCm39)	missense	probably damaging	0.97
R7167:Reln	UTSW	5	22,147,618 (GRCm39)	missense	probably damaging	1.00
R7190:Reln	UTSW	5	22,252,945 (GRCm39)	missense	probably damaging	1.00
R7256:Reln	UTSW	5	22,183,921 (GRCm39)	missense	probably benign	0.03
R7393:Reln	UTSW	5	22,181,349 (GRCm39)	missense	probably damaging	0.99
R7399:Reln	UTSW	5	22,256,365 (GRCm39)	missense	probably damaging	0.99
R7400:Reln	UTSW	5	22,176,932 (GRCm39)	missense	probably damaging	0.99
R7426:Reln	UTSW	5	22,176,951 (GRCm39)	missense	probably damaging	1.00
R7463:Reln	UTSW	5	22,308,433 (GRCm39)	missense	probably damaging	0.98
R7470:Reln	UTSW	5	22,147,739 (GRCm39)	missense	probably damaging	0.99
R7473:Reln	UTSW	5	22,134,125 (GRCm39)	missense	probably benign	0.25
R7501:Reln	UTSW	5	22,432,636 (GRCm39)	missense	possibly damaging	0.91
R7542:Reln	UTSW	5	22,160,179 (GRCm39)	missense	probably damaging	1.00
R7544:Reln	UTSW	5	22,181,276 (GRCm39)	nonsense	probably null
R7588:Reln	UTSW	5	22,090,566 (GRCm39)	missense	probably benign	0.03
R7631:Reln	UTSW	5	22,176,933 (GRCm39)	missense	probably damaging	0.97
R7644:Reln	UTSW	5	22,183,929 (GRCm39)	missense	probably benign	0.39
R7834:Reln	UTSW	5	22,244,633 (GRCm39)	missense	possibly damaging	0.94
R7923:Reln	UTSW	5	22,339,690 (GRCm39)	missense	probably benign	0.00
R7938:Reln	UTSW	5	22,155,870 (GRCm39)	missense	probably damaging	0.97
R8006:Reln	UTSW	5	22,104,082 (GRCm39)	nonsense	probably null
R8062:Reln	UTSW	5	22,176,990 (GRCm39)	missense	probably benign	0.00
R8222:Reln	UTSW	5	22,136,475 (GRCm39)	nonsense	probably null
R8266:Reln	UTSW	5	22,223,085 (GRCm39)	missense	possibly damaging	0.62
R8267:Reln	UTSW	5	22,209,110 (GRCm39)	missense	probably damaging	1.00
R8487:Reln	UTSW	5	22,104,027 (GRCm39)	missense	probably benign	0.03
R8523:Reln	UTSW	5	22,209,229 (GRCm39)	missense	probably damaging	1.00
R8751:Reln	UTSW	5	22,147,672 (GRCm39)	missense	probably benign	0.37
R8801:Reln	UTSW	5	22,155,854 (GRCm39)	missense	possibly damaging	0.94
R8802:Reln	UTSW	5	22,130,257 (GRCm39)	missense	probably damaging	0.98
R8978:Reln	UTSW	5	22,090,512 (GRCm39)	missense	possibly damaging	0.85
R8988:Reln	UTSW	5	22,104,155 (GRCm39)	missense	probably damaging	0.97
R8995:Reln	UTSW	5	22,184,577 (GRCm39)	missense	probably benign	0.00
R9022:Reln	UTSW	5	22,181,613 (GRCm39)	missense	possibly damaging	0.66
R9042:Reln	UTSW	5	22,253,036 (GRCm39)	missense	probably damaging	1.00
R9069:Reln	UTSW	5	22,216,059 (GRCm39)	missense	probably damaging	1.00
R9089:Reln	UTSW	5	22,130,198 (GRCm39)	missense	probably benign	0.01
R9126:Reln	UTSW	5	22,160,194 (GRCm39)	missense	probably damaging	1.00
R9172:Reln	UTSW	5	22,155,815 (GRCm39)	critical splice donor site	probably null
R9182:Reln	UTSW	5	22,106,617 (GRCm39)	missense	probably benign	0.44
R9196:Reln	UTSW	5	22,357,471 (GRCm39)	missense	probably damaging	1.00
R9211:Reln	UTSW	5	22,549,200 (GRCm39)	nonsense	probably null
R9241:Reln	UTSW	5	22,174,067 (GRCm39)	missense	probably damaging	0.99
R9244:Reln	UTSW	5	22,120,151 (GRCm39)	missense	probably damaging	0.99
R9281:Reln	UTSW	5	22,153,545 (GRCm39)	missense	probably damaging	1.00
R9295:Reln	UTSW	5	22,209,209 (GRCm39)	missense	possibly damaging	0.95
R9303:Reln	UTSW	5	22,193,705 (GRCm39)	missense	possibly damaging	0.95
R9303:Reln	UTSW	5	22,285,689 (GRCm39)	missense	probably benign	0.01
R9309:Reln	UTSW	5	22,176,866 (GRCm39)	missense	probably benign	0.37
R9338:Reln	UTSW	5	22,202,937 (GRCm39)	missense	probably damaging	0.98
R9381:Reln	UTSW	5	22,549,202 (GRCm39)	missense	possibly damaging	0.93
R9430:Reln	UTSW	5	22,120,105 (GRCm39)	missense	probably damaging	1.00
R9509:Reln	UTSW	5	22,549,198 (GRCm39)	missense	possibly damaging	0.93
R9515:Reln	UTSW	5	22,125,508 (GRCm39)	missense	possibly damaging	0.46
R9717:Reln	UTSW	5	22,136,427 (GRCm39)	missense	probably benign	0.26
R9745:Reln	UTSW	5	22,152,525 (GRCm39)	missense	probably damaging	1.00
R9778:Reln	UTSW	5	22,155,943 (GRCm39)	missense	probably damaging	1.00
Z1176:Reln	UTSW	5	22,184,022 (GRCm39)	missense	probably damaging	1.00
Z1177:Reln	UTSW	5	22,209,080 (GRCm39)	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	22,174,239 (GRCm39)	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	22,432,634 (GRCm39)	missense	probably damaging	1.00
Z1177:Reln	UTSW	5	22,359,957 (GRCm39)	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TGACACAGGTTCCAAACAGTCC -3'
(R):5'- ACCAGATCTGAGATGGCTGACAG -3'

Sequencing Primer
(F):5'- TGGACACCCAGGCTTCTGTAC -3'
(R):5'- GTTAAAACCCAAATCTGGGG -3'

Posted On

2016-12-20