Incidental Mutation 'R5815:Rnf126'
ID449001
Institutional Source Beutler Lab
Gene Symbol Rnf126
Ensembl Gene ENSMUSG00000035890
Gene Namering finger protein 126
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.426) question?
Stock #R5815 (G1)
Quality Score81
Status Not validated
Chromosome10
Chromosomal Location79758515-79766952 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79766769 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 20 (I20N)
Ref Sequence ENSEMBL: ENSMUSP00000039486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047203]
PDB Structure
Solution structure of the Zinc finger, C3HC4 type (RING finger) domain of RING finger protein 126 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000047203
AA Change: I20N

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000039486
Gene: ENSMUSG00000035890
AA Change: I20N

DomainStartEndE-ValueType
Pfam:zinc_ribbon_9 9 40 5e-11 PFAM
low complexity region 109 121 N/A INTRINSIC
low complexity region 124 139 N/A INTRINSIC
RING 231 271 5.68e-9 SMART
low complexity region 293 313 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219189
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afmid A G 11: 117,835,704 D226G probably benign Het
Ago2 T C 15: 73,107,366 probably null Het
Aldh1a1 C A 19: 20,630,670 D285E probably benign Het
Alms1 T C 6: 85,622,838 S1549P probably damaging Het
Apmap T C 2: 150,600,251 S68G probably benign Het
Atp8a1 A T 5: 67,749,071 I500N probably benign Het
B3gnt7 A C 1: 86,305,788 D135A probably benign Het
Bms1 A T 6: 118,404,279 L692H probably damaging Het
Cdk17 T A 10: 93,228,697 V276E probably damaging Het
Cep290 A T 10: 100,558,108 E2059V possibly damaging Het
Cpxm2 C A 7: 132,044,110 G693V probably damaging Het
Crocc A T 4: 141,035,196 V661E probably damaging Het
D11Wsu47e C A 11: 113,687,957 probably null Het
D1Pas1 A T 1: 186,968,009 N45I probably damaging Het
Ddx19a C T 8: 110,979,149 W223* probably null Het
Ddx60 C A 8: 61,963,722 S567Y probably damaging Het
Dhx36 A T 3: 62,493,755 N363K probably damaging Het
Gpr151 G A 18: 42,579,385 T76M probably benign Het
Inhbc C T 10: 127,357,449 V233I probably benign Het
Ippk C T 13: 49,446,363 L233F probably damaging Het
Lama2 A G 10: 26,986,851 V2972A probably damaging Het
Lrrc37a T C 11: 103,503,786 Q271R probably benign Het
Mia2 A T 12: 59,174,106 K1083N possibly damaging Het
Mphosph9 A C 5: 124,315,418 L277R probably damaging Het
Myo7b A T 18: 31,966,288 F1694I probably damaging Het
Obscn T C 11: 59,082,189 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1361 T C 13: 21,658,537 Y262C probably damaging Het
Pcdh10 A G 3: 45,392,721 T984A probably benign Het
Pcdh20 T C 14: 88,470,876 S39G probably benign Het
Pdia3 T A 2: 121,436,411 Y467* probably null Het
Ptpn13 C A 5: 103,597,690 probably null Het
Reln A G 5: 21,947,433 M2345T probably damaging Het
Satb1 A G 17: 51,782,953 S289P possibly damaging Het
Scd4 A T 19: 44,337,564 H119L probably damaging Het
Sco2 T C 15: 89,372,371 T27A probably benign Het
Slc39a14 A T 14: 70,306,745 I464N probably damaging Het
Slc4a8 T A 15: 100,788,211 V220E probably benign Het
Themis3 C T 17: 66,555,704 V420I possibly damaging Het
Tmf1 T A 6: 97,173,403 T448S probably benign Het
Tspan33 G A 6: 29,710,689 R87Q probably damaging Het
Vmn2r91 A T 17: 18,106,202 M250L probably benign Het
Zc3h7a A T 16: 11,156,186 V245D probably damaging Het
Other mutations in Rnf126
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0087:Rnf126 UTSW 10 79759234 missense probably damaging 0.97
R0302:Rnf126 UTSW 10 79759223 missense probably damaging 1.00
R0418:Rnf126 UTSW 10 79762643 unclassified probably benign
R0671:Rnf126 UTSW 10 79761607 missense possibly damaging 0.83
R1403:Rnf126 UTSW 10 79760868 missense probably benign 0.00
R1449:Rnf126 UTSW 10 79761614 missense probably benign 0.31
R2058:Rnf126 UTSW 10 79759137 unclassified probably benign
R3153:Rnf126 UTSW 10 79761631 missense probably damaging 1.00
R3154:Rnf126 UTSW 10 79761631 missense probably damaging 1.00
R5535:Rnf126 UTSW 10 79762699 missense probably damaging 1.00
R6622:Rnf126 UTSW 10 79761563 critical splice donor site probably null
R6748:Rnf126 UTSW 10 79762136 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTAGCACAAGGCCTGTAACAG -3'
(R):5'- ATTTTGTCCTAGTGCGGCCAC -3'

Sequencing Primer
(F):5'- GATTCGCAGCTCCTCTGG -3'
(R):5'- GTTCTCCACGAGTCAGCC -3'
Posted On2016-12-20