Incidental Mutation 'R5815:Olfr1361'
ID449010
Institutional Source Beutler Lab
Gene Symbol Olfr1361
Ensembl Gene ENSMUSG00000049737
Gene Nameolfactory receptor 1361
SynonymsGA_x6K02T2QHY8-11577590-11578528, MOR256-12
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R5815 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location21656880-21663386 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21658537 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 262 (Y262C)
Ref Sequence ENSEMBL: ENSMUSP00000150315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055615] [ENSMUST00000214321]
Predicted Effect probably damaging
Transcript: ENSMUST00000055615
AA Change: Y262C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062356
Gene: ENSMUSG00000049737
AA Change: Y262C

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 30 312 4.2e-10 PFAM
Pfam:7tm_4 36 313 7.7e-52 PFAM
Pfam:7tm_1 46 295 1.5e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214321
AA Change: Y262C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afmid A G 11: 117,835,704 D226G probably benign Het
Ago2 T C 15: 73,107,366 probably null Het
Aldh1a1 C A 19: 20,630,670 D285E probably benign Het
Alms1 T C 6: 85,622,838 S1549P probably damaging Het
Apmap T C 2: 150,600,251 S68G probably benign Het
Atp8a1 A T 5: 67,749,071 I500N probably benign Het
B3gnt7 A C 1: 86,305,788 D135A probably benign Het
Bms1 A T 6: 118,404,279 L692H probably damaging Het
Cdk17 T A 10: 93,228,697 V276E probably damaging Het
Cep290 A T 10: 100,558,108 E2059V possibly damaging Het
Cpxm2 C A 7: 132,044,110 G693V probably damaging Het
Crocc A T 4: 141,035,196 V661E probably damaging Het
D11Wsu47e C A 11: 113,687,957 probably null Het
D1Pas1 A T 1: 186,968,009 N45I probably damaging Het
Ddx19a C T 8: 110,979,149 W223* probably null Het
Ddx60 C A 8: 61,963,722 S567Y probably damaging Het
Dhx36 A T 3: 62,493,755 N363K probably damaging Het
Gpr151 G A 18: 42,579,385 T76M probably benign Het
Inhbc C T 10: 127,357,449 V233I probably benign Het
Ippk C T 13: 49,446,363 L233F probably damaging Het
Lama2 A G 10: 26,986,851 V2972A probably damaging Het
Lrrc37a T C 11: 103,503,786 Q271R probably benign Het
Mia2 A T 12: 59,174,106 K1083N possibly damaging Het
Mphosph9 A C 5: 124,315,418 L277R probably damaging Het
Myo7b A T 18: 31,966,288 F1694I probably damaging Het
Obscn T C 11: 59,082,189 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Pcdh10 A G 3: 45,392,721 T984A probably benign Het
Pcdh20 T C 14: 88,470,876 S39G probably benign Het
Pdia3 T A 2: 121,436,411 Y467* probably null Het
Ptpn13 C A 5: 103,597,690 probably null Het
Reln A G 5: 21,947,433 M2345T probably damaging Het
Rnf126 A T 10: 79,766,769 I20N probably benign Het
Satb1 A G 17: 51,782,953 S289P possibly damaging Het
Scd4 A T 19: 44,337,564 H119L probably damaging Het
Sco2 T C 15: 89,372,371 T27A probably benign Het
Slc39a14 A T 14: 70,306,745 I464N probably damaging Het
Slc4a8 T A 15: 100,788,211 V220E probably benign Het
Themis3 C T 17: 66,555,704 V420I possibly damaging Het
Tmf1 T A 6: 97,173,403 T448S probably benign Het
Tspan33 G A 6: 29,710,689 R87Q probably damaging Het
Vmn2r91 A T 17: 18,106,202 M250L probably benign Het
Zc3h7a A T 16: 11,156,186 V245D probably damaging Het
Other mutations in Olfr1361
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01878:Olfr1361 APN 13 21658783 missense possibly damaging 0.63
IGL02025:Olfr1361 APN 13 21659263 missense possibly damaging 0.92
IGL02275:Olfr1361 APN 13 21659000 missense probably benign 0.01
IGL02831:Olfr1361 APN 13 21658904 missense probably benign
IGL02932:Olfr1361 APN 13 21658831 missense probably damaging 1.00
R0102:Olfr1361 UTSW 13 21658735 missense probably damaging 1.00
R0597:Olfr1361 UTSW 13 21659146 missense probably damaging 0.96
R1669:Olfr1361 UTSW 13 21659286 missense possibly damaging 0.91
R2006:Olfr1361 UTSW 13 21658472 missense possibly damaging 0.94
R2292:Olfr1361 UTSW 13 21658831 missense probably damaging 1.00
R4894:Olfr1361 UTSW 13 21659182 missense probably damaging 1.00
R4919:Olfr1361 UTSW 13 21658624 missense possibly damaging 0.59
R5339:Olfr1361 UTSW 13 21659234 missense probably benign 0.37
R6248:Olfr1361 UTSW 13 21659074 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GACCATTCCTAGGTCTGATAGC -3'
(R):5'- TATGGCCTTGGAAGCACTGG -3'

Sequencing Primer
(F):5'- AATACCCAAATGTGTTCATCCCTTG -3'
(R):5'- GCTTTTGCGTTGGCGATTTTTATC -3'
Posted On2016-12-20