Incidental Mutation 'R0547:Eif4g2'
ID44904
Institutional Source Beutler Lab
Gene Symbol Eif4g2
Ensembl Gene ENSMUSG00000005610
Gene Nameeukaryotic translation initiation factor 4, gamma 2
SynonymsDAP-5, Nat1, E130105L11Rik, Natm1
MMRRC Submission 038739-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0547 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location111067750-111083030 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111078293 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 177 (N177S)
Ref Sequence ENSEMBL: ENSMUSP00000124551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159305] [ENSMUST00000160132] [ENSMUST00000160966] [ENSMUST00000161051] [ENSMUST00000162415]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158323
Predicted Effect probably benign
Transcript: ENSMUST00000159305
SMART Domains Protein: ENSMUSP00000125098
Gene: ENSMUSG00000005610

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
Blast:MIF4G 32 83 4e-22 BLAST
SCOP:d1hu3a_ 67 102 9e-13 SMART
PDB:4IUL|B 70 102 3e-15 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159465
Predicted Effect probably benign
Transcript: ENSMUST00000160132
SMART Domains Protein: ENSMUSP00000124914
Gene: ENSMUSG00000005610

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 61 69 N/A INTRINSIC
Pfam:MIF4G 78 152 1.3e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160552
Predicted Effect probably benign
Transcript: ENSMUST00000160966
Predicted Effect probably damaging
Transcript: ENSMUST00000161051
AA Change: N177S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125375
Gene: ENSMUSG00000005610
AA Change: N177S

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 61 69 N/A INTRINSIC
MIF4G 78 308 2.08e-58 SMART
MA3 505 618 4.76e-35 SMART
low complexity region 634 646 N/A INTRINSIC
low complexity region 682 704 N/A INTRINSIC
low complexity region 760 771 N/A INTRINSIC
eIF5C 775 861 5.43e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162394
Predicted Effect probably damaging
Transcript: ENSMUST00000162415
AA Change: N177S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124551
Gene: ENSMUSG00000005610
AA Change: N177S

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 61 69 N/A INTRINSIC
MIF4G 78 308 2.08e-58 SMART
low complexity region 441 453 N/A INTRINSIC
Blast:MIF4G 454 490 4e-14 BLAST
MA3 543 656 4.76e-35 SMART
low complexity region 672 684 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 798 809 N/A INTRINSIC
eIF5C 813 899 5.43e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163014
SMART Domains Protein: ENSMUSP00000123811
Gene: ENSMUSG00000005610

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
Pfam:W2 52 122 2.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209597
Meta Mutation Damage Score 0.278 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: Translation initiation is mediated by specific recognition of the cap structure by eukaryotic translation initiation factor 4F (eIF4F), which is a cap binding protein complex that consists of three subunits: eIF4A, eIF4E and eIF4G. The protein encoded by this gene shares similarity with the C-terminal region of eIF4G, that contains the binding sites for eIF4A and eIF3; eIF4G in addition, contains a binding site for eIF4E at the N-terminus. Unlike eIF4G which supports cap-dependent and independent translation, this gene product functions as a general repressor of translation by forming translationally inactive complexes. Transgene expression of the apolipoprotein B mRNA-editing enzyme (APOBEC-1) causes extensive editing of this mRNA, which could contribute to the potent oncogenesis induced by overexpression of APOBEC-1. In vitro and in vivo studies in human indicate that translation of this mRNA initiates exclusively at a non-AUG (GUG) codon. This also appears to be true for mouse. Two alternatively spliced transcript variants that encode different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation fail to undergo gastrulation and die by E11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057N15Rik A G 16: 88,773,610 Y181H probably benign Het
A530084C06Rik A G 13: 31,558,830 probably benign Het
Adamtsl1 A G 4: 86,356,355 D1208G probably benign Het
Ankrd55 T C 13: 112,368,223 F501S probably benign Het
Aox2 G A 1: 58,310,042 D656N probably damaging Het
Atr A T 9: 95,899,165 probably benign Het
Bicra G A 7: 15,972,248 R1423W probably damaging Het
Cabyr T A 18: 12,751,016 S187T probably benign Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Cdon A T 9: 35,457,498 T343S possibly damaging Het
Cep350 C T 1: 155,901,435 probably null Het
Copa T C 1: 172,121,687 probably benign Het
Cyp4f18 T C 8: 71,996,010 D265G probably benign Het
Dgkb T A 12: 38,604,158 C759S probably benign Het
Dnah6 T C 6: 73,044,774 M3470V probably benign Het
Etfb C T 7: 43,454,578 Q145* probably null Het
Flnb T A 14: 7,912,943 probably null Het
G430095P16Rik G A 8: 84,726,642 probably benign Het
Gfral A T 9: 76,208,642 S17T probably benign Het
Gm884 T C 11: 103,620,164 N326S unknown Het
Gpr26 T C 7: 131,984,297 I332T probably benign Het
Greb1 T A 12: 16,723,411 T221S probably benign Het
Haus5 A T 7: 30,659,083 S289T probably damaging Het
Ighv6-4 T C 12: 114,406,601 Y77C probably damaging Het
Il23r A T 6: 67,423,701 D548E probably benign Het
Il23r A T 6: 67,486,251 F86Y possibly damaging Het
Inppl1 A T 7: 101,831,003 M424K probably benign Het
Jam3 A G 9: 27,098,888 Y267H probably damaging Het
Mms19 A T 19: 41,963,418 M160K probably damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Mup5 A G 4: 61,833,000 L137P probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Ntrk2 G A 13: 58,874,370 S413N probably damaging Het
Nuak2 C A 1: 132,332,203 T573N probably benign Het
Odf3 A G 7: 140,848,815 probably null Het
Olfr651 G A 7: 104,553,356 V146M probably benign Het
Olfr734 A T 14: 50,320,118 I239K probably benign Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pclo T A 5: 14,792,072 I4787N unknown Het
Pde8a G T 7: 81,324,130 V612L probably benign Het
Pear1 A T 3: 87,788,800 probably null Het
Pgbd1 A G 13: 21,423,518 Y169H probably damaging Het
Pkd1l1 A G 11: 8,836,448 probably benign Het
Prkag3 C T 1: 74,744,720 probably null Het
Rsph9 A T 17: 46,144,124 S9T possibly damaging Het
Rxfp1 A T 3: 79,705,569 probably null Het
Senp7 A G 16: 56,175,826 E756G probably damaging Het
Serpina1e G T 12: 103,949,191 T252K probably benign Het
Sipa1l1 T A 12: 82,437,736 S1555T probably benign Het
Slain1 T C 14: 103,695,275 S432P probably damaging Het
Slc37a2 A T 9: 37,233,122 probably null Het
Thg1l C T 11: 45,954,191 R18Q probably damaging Het
Tnn A G 1: 160,116,337 probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Tshz3 A G 7: 36,771,417 T944A probably damaging Het
Ttn C G 2: 76,854,430 probably benign Het
Ythdc2 T C 18: 44,840,264 S323P possibly damaging Het
Zfp827 A G 8: 79,060,310 N35S probably damaging Het
Other mutations in Eif4g2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Eif4g2 APN 7 111074713 missense possibly damaging 0.91
IGL01402:Eif4g2 APN 7 111077027 missense possibly damaging 0.94
IGL02502:Eif4g2 APN 7 111081541 missense probably damaging 0.98
IGL02538:Eif4g2 APN 7 111079316 missense probably benign 0.03
IGL02717:Eif4g2 APN 7 111078113 missense probably benign 0.45
R0614:Eif4g2 UTSW 7 111077223 critical splice donor site probably null
R1351:Eif4g2 UTSW 7 111074080 missense probably damaging 1.00
R1764:Eif4g2 UTSW 7 111074487 missense probably damaging 1.00
R2009:Eif4g2 UTSW 7 111074198 missense probably benign 0.01
R2318:Eif4g2 UTSW 7 111073858 missense possibly damaging 0.78
R2382:Eif4g2 UTSW 7 111075046 missense probably benign 0.00
R2986:Eif4g2 UTSW 7 111078483 missense probably damaging 0.99
R4012:Eif4g2 UTSW 7 111074151 missense possibly damaging 0.86
R4592:Eif4g2 UTSW 7 111078302 missense probably damaging 1.00
R4785:Eif4g2 UTSW 7 111076796 missense probably damaging 0.99
R5037:Eif4g2 UTSW 7 111077032 missense probably benign 0.03
R5627:Eif4g2 UTSW 7 111074239 missense probably benign 0.32
R5988:Eif4g2 UTSW 7 111077230 missense probably benign 0.11
R6229:Eif4g2 UTSW 7 111077713 unclassified probably null
Predicted Primers PCR Primer
(F):5'- AATTGTGACTGCCTCACCCCTAACC -3'
(R):5'- TGCACCAAACTTTGATGGCCCAGC -3'

Sequencing Primer
(F):5'- AAGCTTGCCAAGTTCTCCAATG -3'
(R):5'- TTGATGGCCCAGCAGCAG -3'
Posted On2013-06-11