Incidental Mutation 'R5816:Kdm3b'
ID449071
Institutional Source Beutler Lab
Gene Symbol Kdm3b
Ensembl Gene ENSMUSG00000038773
Gene NameKDM3B lysine (K)-specific demethylase 3B
SynonymsJHDM2B, Jmjd1b, 5830462I21Rik
MMRRC Submission 043214-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.668) question?
Stock #R5816 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location34777047-34838660 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 34828469 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 1433 (E1433A)
Ref Sequence ENSEMBL: ENSMUSP00000037628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043775] [ENSMUST00000225195]
Predicted Effect probably damaging
Transcript: ENSMUST00000043775
AA Change: E1433A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037628
Gene: ENSMUSG00000038773
AA Change: E1433A

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
Blast:JmjC 149 944 N/A BLAST
Blast:JmjC 946 1064 5e-40 BLAST
Blast:JmjC 1069 1471 N/A BLAST
JmjC 1499 1722 2.43e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223567
Predicted Effect possibly damaging
Transcript: ENSMUST00000225195
AA Change: E1233A

PolyPhen 2 Score 0.654 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 T C 11: 94,343,737 D1501G probably damaging Het
Aldh8a1 A T 10: 21,395,430 I352F probably damaging Het
Bend7 G A 2: 4,744,332 E87K probably damaging Het
Bend7 A G 2: 4,752,899 R251G probably benign Het
Cep72 A T 13: 74,049,031 S402T probably benign Het
Cer1 A G 4: 82,882,883 V181A probably damaging Het
Ces1b T C 8: 93,073,262 N162S probably benign Het
Cyp1a2 T C 9: 57,681,053 N296S probably benign Het
Dst C T 1: 34,179,234 A1585V probably benign Het
Dzip1 G A 14: 118,909,480 P339L probably benign Het
Eif4enif1 T C 11: 3,242,401 I568T probably benign Het
Eif5a C T 11: 69,917,673 R109Q possibly damaging Het
Fam49a A G 12: 12,358,165 D64G probably benign Het
Foxj2 G A 6: 122,833,736 S225N probably benign Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,965 probably benign Het
Galnt14 T C 17: 73,574,882 Y74C probably damaging Het
Glrb T A 3: 80,861,979 N147I probably damaging Het
Grb14 A T 2: 64,917,284 M377K probably damaging Het
Kcng1 C T 2: 168,268,723 E174K possibly damaging Het
Matn3 G A 12: 8,970,571 R481H probably damaging Het
Mcm6 A G 1: 128,348,455 V331A probably benign Het
Mdga2 T C 12: 66,655,182 Y415C probably damaging Het
Med11 T C 11: 70,452,285 S65P probably damaging Het
Metrnl T A 11: 121,708,112 S166T probably benign Het
Mllt6 A G 11: 97,672,574 K328E probably damaging Het
Nek5 T C 8: 22,096,736 K353R probably benign Het
Olfr599 A G 7: 103,338,995 T314A probably benign Het
Olfr965 T A 9: 39,719,230 M1K probably null Het
Pfkl A T 10: 78,002,022 N46K possibly damaging Het
Phactr3 A G 2: 178,302,793 E428G probably damaging Het
Pkhd1 T C 1: 20,058,678 S3934G probably benign Het
Pkhd1l1 A G 15: 44,566,322 D3312G probably benign Het
Prmt8 G A 6: 127,697,738 T309I probably benign Het
Psd3 A T 8: 67,960,510 V742E possibly damaging Het
S100a14 A G 3: 90,527,850 H56R probably damaging Het
Scaf8 T A 17: 3,177,713 S406T unknown Het
Slc26a4 G T 12: 31,528,685 H656Q probably damaging Het
Smarcc1 T C 9: 110,197,644 V724A possibly damaging Het
Thbs2 C T 17: 14,684,071 probably null Het
Zbtb6 A T 2: 37,429,215 F234I probably benign Het
Zfp536 C T 7: 37,480,628 D851N probably damaging Het
Other mutations in Kdm3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Kdm3b APN 18 34809409 missense probably benign 0.03
IGL01357:Kdm3b APN 18 34793014 missense probably damaging 1.00
IGL01615:Kdm3b APN 18 34829231 missense probably damaging 1.00
IGL01980:Kdm3b APN 18 34834236 missense probably damaging 1.00
IGL02277:Kdm3b APN 18 34823664 missense probably damaging 1.00
IGL02346:Kdm3b APN 18 34834238 missense probably damaging 1.00
IGL02417:Kdm3b APN 18 34808577 missense probably benign 0.03
IGL02531:Kdm3b APN 18 34795729 missense probably benign
IGL02589:Kdm3b APN 18 34812418 missense possibly damaging 0.89
IGL02793:Kdm3b APN 18 34829019 missense probably damaging 0.99
IGL03121:Kdm3b APN 18 34795709 missense probably damaging 0.98
IGL03123:Kdm3b APN 18 34809491 critical splice donor site probably null
IGL03128:Kdm3b APN 18 34827427 missense probably damaging 1.00
PIT4382001:Kdm3b UTSW 18 34809087 missense probably damaging 1.00
PIT4445001:Kdm3b UTSW 18 34793115 nonsense probably null
R0068:Kdm3b UTSW 18 34824774 missense probably benign 0.18
R0068:Kdm3b UTSW 18 34824774 missense probably benign 0.18
R0233:Kdm3b UTSW 18 34809420 missense probably damaging 0.97
R0265:Kdm3b UTSW 18 34795663 splice site probably benign
R0306:Kdm3b UTSW 18 34804017 missense probably benign 0.35
R0941:Kdm3b UTSW 18 34803552 missense probably damaging 0.99
R0970:Kdm3b UTSW 18 34809039 missense probably damaging 1.00
R1061:Kdm3b UTSW 18 34796862 missense probably damaging 1.00
R1104:Kdm3b UTSW 18 34819811 missense probably damaging 1.00
R1221:Kdm3b UTSW 18 34808245 missense possibly damaging 0.57
R1486:Kdm3b UTSW 18 34834304 missense probably damaging 1.00
R1523:Kdm3b UTSW 18 34793173 critical splice donor site probably null
R1558:Kdm3b UTSW 18 34809096 missense probably damaging 1.00
R1585:Kdm3b UTSW 18 34809292 missense probably damaging 1.00
R1601:Kdm3b UTSW 18 34808731 missense probably damaging 1.00
R1650:Kdm3b UTSW 18 34809115 missense possibly damaging 0.93
R1772:Kdm3b UTSW 18 34803504 missense probably benign 0.01
R1853:Kdm3b UTSW 18 34833393 missense probably damaging 1.00
R1934:Kdm3b UTSW 18 34813544 missense probably benign 0.04
R1959:Kdm3b UTSW 18 34812395 missense possibly damaging 0.55
R2079:Kdm3b UTSW 18 34803517 missense probably damaging 1.00
R2102:Kdm3b UTSW 18 34830147 missense probably damaging 1.00
R2121:Kdm3b UTSW 18 34796780 splice site probably benign
R2281:Kdm3b UTSW 18 34808419 missense probably damaging 1.00
R3719:Kdm3b UTSW 18 34808671 missense probably damaging 1.00
R3755:Kdm3b UTSW 18 34808296 missense probably benign
R3857:Kdm3b UTSW 18 34833387 missense probably benign
R4165:Kdm3b UTSW 18 34795744 missense probably benign 0.01
R4166:Kdm3b UTSW 18 34795744 missense probably benign 0.01
R4372:Kdm3b UTSW 18 34827444 missense probably benign 0.00
R4672:Kdm3b UTSW 18 34808577 missense probably benign
R4933:Kdm3b UTSW 18 34810393 missense probably damaging 1.00
R4969:Kdm3b UTSW 18 34822375 missense probably damaging 1.00
R5009:Kdm3b UTSW 18 34824710 missense probably benign 0.42
R5059:Kdm3b UTSW 18 34777197 missense possibly damaging 0.83
R5092:Kdm3b UTSW 18 34813462 missense probably benign 0.16
R5270:Kdm3b UTSW 18 34827414 missense probably damaging 1.00
R5970:Kdm3b UTSW 18 34829289 missense probably damaging 1.00
R6244:Kdm3b UTSW 18 34793005 missense probably damaging 1.00
R6705:Kdm3b UTSW 18 34819873 missense probably damaging 1.00
R6723:Kdm3b UTSW 18 34793005 missense probably damaging 0.99
R6909:Kdm3b UTSW 18 34827328 splice site probably null
R6958:Kdm3b UTSW 18 34808283 missense probably benign 0.00
R7026:Kdm3b UTSW 18 34822464 missense possibly damaging 0.90
R7289:Kdm3b UTSW 18 34794504 missense probably benign 0.00
X0028:Kdm3b UTSW 18 34799266 intron probably null
X0067:Kdm3b UTSW 18 34823517 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTCCTCCAGAGTGAGAACAC -3'
(R):5'- TCGAAACAGAAGGCTCCTCC -3'

Sequencing Primer
(F):5'- CACAGTATAAGAGCAGAGTAGAGGCC -3'
(R):5'- AGAAGGCTCCTCCCTCCATG -3'
Posted On2016-12-20