Incidental Mutation 'R0547:Zfp827'
ID44908
Institutional Source Beutler Lab
Gene Symbol Zfp827
Ensembl Gene ENSMUSG00000071064
Gene Namezinc finger protein 827
Synonyms2810449M09Rik, D630040G17Rik
MMRRC Submission 038739-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.353) question?
Stock #R0547 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location79028437-79193766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79060310 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 35 (N35S)
Ref Sequence ENSEMBL: ENSMUSP00000096214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087927] [ENSMUST00000098614] [ENSMUST00000119254]
Predicted Effect probably damaging
Transcript: ENSMUST00000087927
AA Change: N35S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085238
Gene: ENSMUSG00000071064
AA Change: N35S

DomainStartEndE-ValueType
low complexity region 102 128 N/A INTRINSIC
low complexity region 226 256 N/A INTRINSIC
low complexity region 271 298 N/A INTRINSIC
low complexity region 306 342 N/A INTRINSIC
low complexity region 343 348 N/A INTRINSIC
ZnF_C2H2 371 393 6.78e-3 SMART
ZnF_C2H2 399 422 5.59e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098614
AA Change: N35S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096214
Gene: ENSMUSG00000071064
AA Change: N35S

DomainStartEndE-ValueType
low complexity region 102 128 N/A INTRINSIC
low complexity region 226 256 N/A INTRINSIC
low complexity region 271 298 N/A INTRINSIC
low complexity region 306 342 N/A INTRINSIC
low complexity region 343 348 N/A INTRINSIC
ZnF_C2H2 371 393 6.78e-3 SMART
ZnF_C2H2 399 421 2.99e-4 SMART
ZnF_C2H2 430 452 5.42e-2 SMART
internal_repeat_2 561 585 3.31e-7 PROSPERO
low complexity region 613 627 N/A INTRINSIC
internal_repeat_2 719 743 3.31e-7 PROSPERO
ZnF_C2H2 814 836 2.4e-3 SMART
ZnF_C2H2 842 864 4.72e-2 SMART
ZnF_C2H2 894 916 1.64e-1 SMART
ZnF_C2H2 926 949 7.89e0 SMART
low complexity region 956 974 N/A INTRINSIC
ZnF_C2H2 1016 1038 1.26e-2 SMART
ZnF_C2H2 1044 1066 3.07e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119254
AA Change: N35S

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113199
Gene: ENSMUSG00000071064
AA Change: N35S

DomainStartEndE-ValueType
low complexity region 102 128 N/A INTRINSIC
low complexity region 226 256 N/A INTRINSIC
low complexity region 271 298 N/A INTRINSIC
low complexity region 306 342 N/A INTRINSIC
low complexity region 343 348 N/A INTRINSIC
ZnF_C2H2 371 393 6.78e-3 SMART
ZnF_C2H2 399 421 2.99e-4 SMART
ZnF_C2H2 430 452 5.42e-2 SMART
internal_repeat_2 561 585 3.25e-7 PROSPERO
low complexity region 613 627 N/A INTRINSIC
internal_repeat_2 719 743 3.25e-7 PROSPERO
ZnF_C2H2 814 836 2.4e-3 SMART
ZnF_C2H2 842 864 4.72e-2 SMART
ZnF_C2H2 894 916 1.64e-1 SMART
ZnF_C2H2 926 949 7.89e0 SMART
low complexity region 956 974 N/A INTRINSIC
ZnF_C2H2 1016 1038 1.26e-2 SMART
ZnF_C2H2 1044 1066 3.07e-1 SMART
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057N15Rik A G 16: 88,773,610 Y181H probably benign Het
A530084C06Rik A G 13: 31,558,830 probably benign Het
Adamtsl1 A G 4: 86,356,355 D1208G probably benign Het
Ankrd55 T C 13: 112,368,223 F501S probably benign Het
Aox2 G A 1: 58,310,042 D656N probably damaging Het
Atr A T 9: 95,899,165 probably benign Het
Bicra G A 7: 15,972,248 R1423W probably damaging Het
Cabyr T A 18: 12,751,016 S187T probably benign Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Cdon A T 9: 35,457,498 T343S possibly damaging Het
Cep350 C T 1: 155,901,435 probably null Het
Copa T C 1: 172,121,687 probably benign Het
Cyp4f18 T C 8: 71,996,010 D265G probably benign Het
Dgkb T A 12: 38,604,158 C759S probably benign Het
Dnah6 T C 6: 73,044,774 M3470V probably benign Het
Eif4g2 T C 7: 111,078,293 N177S probably damaging Het
Etfb C T 7: 43,454,578 Q145* probably null Het
Flnb T A 14: 7,912,943 probably null Het
G430095P16Rik G A 8: 84,726,642 probably benign Het
Gfral A T 9: 76,208,642 S17T probably benign Het
Gm884 T C 11: 103,620,164 N326S unknown Het
Gpr26 T C 7: 131,984,297 I332T probably benign Het
Greb1 T A 12: 16,723,411 T221S probably benign Het
Haus5 A T 7: 30,659,083 S289T probably damaging Het
Ighv6-4 T C 12: 114,406,601 Y77C probably damaging Het
Il23r A T 6: 67,423,701 D548E probably benign Het
Il23r A T 6: 67,486,251 F86Y possibly damaging Het
Inppl1 A T 7: 101,831,003 M424K probably benign Het
Jam3 A G 9: 27,098,888 Y267H probably damaging Het
Mms19 A T 19: 41,963,418 M160K probably damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Mup5 A G 4: 61,833,000 L137P probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Ntrk2 G A 13: 58,874,370 S413N probably damaging Het
Nuak2 C A 1: 132,332,203 T573N probably benign Het
Odf3 A G 7: 140,848,815 probably null Het
Olfr651 G A 7: 104,553,356 V146M probably benign Het
Olfr734 A T 14: 50,320,118 I239K probably benign Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pclo T A 5: 14,792,072 I4787N unknown Het
Pde8a G T 7: 81,324,130 V612L probably benign Het
Pear1 A T 3: 87,788,800 probably null Het
Pgbd1 A G 13: 21,423,518 Y169H probably damaging Het
Pkd1l1 A G 11: 8,836,448 probably benign Het
Prkag3 C T 1: 74,744,720 probably null Het
Rsph9 A T 17: 46,144,124 S9T possibly damaging Het
Rxfp1 A T 3: 79,705,569 probably null Het
Senp7 A G 16: 56,175,826 E756G probably damaging Het
Serpina1e G T 12: 103,949,191 T252K probably benign Het
Sipa1l1 T A 12: 82,437,736 S1555T probably benign Het
Slain1 T C 14: 103,695,275 S432P probably damaging Het
Slc37a2 A T 9: 37,233,122 probably null Het
Thg1l C T 11: 45,954,191 R18Q probably damaging Het
Tnn A G 1: 160,116,337 probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Tshz3 A G 7: 36,771,417 T944A probably damaging Het
Ttn C G 2: 76,854,430 probably benign Het
Ythdc2 T C 18: 44,840,264 S323P possibly damaging Het
Other mutations in Zfp827
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Zfp827 APN 8 79060733 missense possibly damaging 0.82
IGL01545:Zfp827 APN 8 79070434 missense probably damaging 1.00
IGL01552:Zfp827 APN 8 79076191 missense probably damaging 1.00
IGL02261:Zfp827 APN 8 79180079 missense probably damaging 0.97
IGL02451:Zfp827 APN 8 79060972 missense probably damaging 1.00
IGL03130:Zfp827 APN 8 79060957 missense probably damaging 1.00
IGL03411:Zfp827 APN 8 79076487 missense probably damaging 0.99
E0354:Zfp827 UTSW 8 79136577 missense probably damaging 1.00
R0502:Zfp827 UTSW 8 79179077 splice site probably null
R0926:Zfp827 UTSW 8 79118192 missense probably benign 0.00
R0975:Zfp827 UTSW 8 79061185 missense probably benign 0.00
R1305:Zfp827 UTSW 8 79060894 missense possibly damaging 0.95
R1462:Zfp827 UTSW 8 79076479 missense probably benign
R1462:Zfp827 UTSW 8 79076479 missense probably benign
R1638:Zfp827 UTSW 8 79076346 missense possibly damaging 0.94
R1714:Zfp827 UTSW 8 79060573 missense probably damaging 1.00
R2044:Zfp827 UTSW 8 79076236 missense probably benign
R2132:Zfp827 UTSW 8 79185721 missense possibly damaging 0.53
R3844:Zfp827 UTSW 8 79136619 missense probably damaging 0.99
R4329:Zfp827 UTSW 8 79189834 utr 3 prime probably benign
R4629:Zfp827 UTSW 8 79060382 missense probably damaging 0.99
R4873:Zfp827 UTSW 8 79060774 missense probably damaging 1.00
R4875:Zfp827 UTSW 8 79060774 missense probably damaging 1.00
R4936:Zfp827 UTSW 8 79061183 missense probably benign
R4965:Zfp827 UTSW 8 79061281 missense probably benign
R5103:Zfp827 UTSW 8 79070403 missense probably damaging 1.00
R5366:Zfp827 UTSW 8 79185704 missense possibly damaging 0.94
R5794:Zfp827 UTSW 8 79070442 missense probably damaging 1.00
R5825:Zfp827 UTSW 8 79179016 missense probably damaging 1.00
R6118:Zfp827 UTSW 8 79076438 missense possibly damaging 0.75
R6236:Zfp827 UTSW 8 79070476 missense probably damaging 1.00
R6263:Zfp827 UTSW 8 79179073 missense probably damaging 1.00
R6306:Zfp827 UTSW 8 79060695 missense probably damaging 1.00
R6490:Zfp827 UTSW 8 79189977 utr 3 prime probably benign
R6497:Zfp827 UTSW 8 79180128 missense probably damaging 1.00
R7250:Zfp827 UTSW 8 79190092 missense
R7290:Zfp827 UTSW 8 79189813 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGTTCAGCTCGTACTGAATCACTGC -3'
(R):5'- AGTCTCGGAGAACCTCACCATCAAG -3'

Sequencing Primer
(F):5'- CTCGTAACATGAGCTAttcttttttc -3'
(R):5'- TCAAGTGCCACCAACTCCAG -3'
Posted On2013-06-11