Incidental Mutation 'R5817:Serpini1'
ID449080
Institutional Source Beutler Lab
Gene Symbol Serpini1
Ensembl Gene ENSMUSG00000027834
Gene Nameserine (or cysteine) peptidase inhibitor, clade I, member 1
SynonymsNeuroserpin, Spi17, Ns, PI12
MMRRC Submission 043397-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R5817 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location75557547-75643495 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75613324 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 76 (M76K)
Ref Sequence ENSEMBL: ENSMUSP00000123845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029423] [ENSMUST00000161776]
Predicted Effect probably benign
Transcript: ENSMUST00000029423
AA Change: M76K

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000029423
Gene: ENSMUSG00000027834
AA Change: M76K

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
SERPIN 31 397 1.46e-158 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161695
Predicted Effect probably benign
Transcript: ENSMUST00000161776
AA Change: M76K

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000123845
Gene: ENSMUSG00000027834
AA Change: M76K

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
SERPIN 31 207 1.15e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195285
Meta Mutation Damage Score 0.072 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serpin superfamily of serine proteinase inhibitors. The protein is primarily secreted by axons in the brain, and preferentially reacts with and inhibits tissue-type plasminogen activator. It is thought to play a role in the regulation of axonal growth and the development of synaptic plasticity. Mutations in this gene result in familial encephalopathy with neuroserpin inclusion bodies (FENIB), which is a dominantly inherited form of familial encephalopathy and epilepsy characterized by the accumulation of mutant neuroserpin polymers. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene show no change in brain morphology or histology. However, they show an increase avoidance of novel stimuli and increased anxiety responses in some situations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A G 4: 144,622,927 I251M probably benign Het
Abcf3 T C 16: 20,549,083 V63A possibly damaging Het
Agpat4 C T 17: 12,215,210 probably benign Het
Ahcyl2 G A 6: 29,890,721 V292M probably damaging Het
Ahnak2 A T 12: 112,774,003 F406I probably damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgef5 G A 6: 43,275,104 D930N probably benign Het
Casc4 T A 2: 121,906,044 S231T probably benign Het
Cc2d2a G A 5: 43,712,418 R887Q probably damaging Het
Ceacam18 A G 7: 43,641,841 T236A probably benign Het
Chst15 A T 7: 132,269,144 Y221N probably damaging Het
Chst15 G A 7: 132,269,147 L220F probably damaging Het
Cntn2 G A 1: 132,518,748 T784I probably benign Het
D630003M21Rik A G 2: 158,196,493 L1011P probably damaging Het
Dync2h1 T A 9: 6,996,905 D3894V probably damaging Het
E330017A01Rik T C 16: 58,636,793 I89V probably benign Het
Fam13b T C 18: 34,457,797 M443V possibly damaging Het
Fam20a T A 11: 109,673,418 Q503L possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm21319 G T 12: 87,773,431 D119E probably benign Het
Gm5454 T A 13: 103,356,632 noncoding transcript Het
Gm5581 A G 6: 131,167,169 noncoding transcript Het
Gm6619 A G 6: 131,486,437 I6V unknown Het
Gmcl1 A G 6: 86,714,248 M255T probably damaging Het
Gprc5c T A 11: 114,863,624 C42* probably null Het
Hmcn1 T A 1: 150,737,524 E1384V possibly damaging Het
Il6 A G 5: 30,018,008 I91V probably benign Het
Kmt2d A T 15: 98,862,363 S1005T unknown Het
Map1a A T 2: 121,298,910 H143L possibly damaging Het
Mical2 A T 7: 112,323,659 T624S probably benign Het
Msh3 A T 13: 92,286,000 N549K possibly damaging Het
Ncr1 T A 7: 4,340,895 I164N possibly damaging Het
Olfr1333 T G 4: 118,830,099 T115P probably damaging Het
Olfr554 A G 7: 102,640,378 N44S probably damaging Het
Olfr586 A T 7: 103,121,908 M292K possibly damaging Het
Olfr926 A G 9: 38,877,377 D67G probably damaging Het
Palmd T C 3: 116,918,623 I541M probably benign Het
Pcsk7 A T 9: 45,926,033 M552L probably benign Het
Plekhh2 A G 17: 84,571,726 E626G possibly damaging Het
Pole G A 5: 110,312,972 D1176N probably damaging Het
Polr2f T C 15: 79,151,669 I110T probably damaging Het
Pomt1 A T 2: 32,248,679 I436F probably damaging Het
Prag1 A C 8: 36,103,703 Q480P probably damaging Het
Qars C T 9: 108,510,242 probably benign Het
Ralgapa2 G A 2: 146,333,486 S1797L probably damaging Het
Rbm26 T C 14: 105,128,603 T832A probably damaging Het
Rnf169 A G 7: 99,925,769 S540P probably benign Het
Shq1 A G 6: 100,573,720 L419S probably damaging Het
Slc25a17 G A 15: 81,327,060 T225M probably damaging Het
Slc6a5 C A 7: 49,956,491 L716I probably benign Het
Smc1b A G 15: 85,067,783 V1149A probably damaging Het
Trappc1 A T 11: 69,324,234 Q26L possibly damaging Het
Trpm2 C A 10: 77,965,980 G84W probably damaging Het
Ttn G A 2: 76,742,666 T24215M probably damaging Het
Ubn2 C A 6: 38,479,153 T337K probably damaging Het
Ubr4 A G 4: 139,468,847 K1265E probably damaging Het
Vmn1r214 T G 13: 23,035,321 I328M probably damaging Het
Xcr1 C T 9: 123,855,857 C280Y possibly damaging Het
Zc3h13 A G 14: 75,328,132 E895G probably damaging Het
Other mutations in Serpini1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Serpini1 APN 3 75640695 nonsense probably null
IGL02131:Serpini1 APN 3 75640704 missense probably benign 0.15
IGL02265:Serpini1 APN 3 75619269 missense probably damaging 0.96
IGL03151:Serpini1 APN 3 75613296 missense probably benign 0.00
IGL03232:Serpini1 APN 3 75638010 splice site probably benign
IGL03256:Serpini1 APN 3 75619174 missense probably benign 0.04
R0021:Serpini1 UTSW 3 75619313 missense probably damaging 1.00
R0021:Serpini1 UTSW 3 75619313 missense probably damaging 1.00
R0449:Serpini1 UTSW 3 75613341 missense probably benign 0.06
R0941:Serpini1 UTSW 3 75616627 missense probably damaging 0.97
R1641:Serpini1 UTSW 3 75614670 missense possibly damaging 0.94
R1968:Serpini1 UTSW 3 75614478 missense probably benign 0.34
R1993:Serpini1 UTSW 3 75614664 missense probably damaging 1.00
R2159:Serpini1 UTSW 3 75623944 missense probably benign 0.06
R3418:Serpini1 UTSW 3 75640282 missense probably damaging 1.00
R3419:Serpini1 UTSW 3 75640282 missense probably damaging 1.00
R3780:Serpini1 UTSW 3 75614635 missense probably damaging 0.96
R4618:Serpini1 UTSW 3 75616576 missense probably benign 0.29
R4864:Serpini1 UTSW 3 75613174 missense probably benign 0.01
R4989:Serpini1 UTSW 3 75614488 missense probably benign 0.07
R5080:Serpini1 UTSW 3 75616660 missense probably damaging 1.00
R5324:Serpini1 UTSW 3 75640294 missense probably damaging 1.00
R5767:Serpini1 UTSW 3 75613081 splice site probably benign
R5912:Serpini1 UTSW 3 75616607 missense probably benign 0.04
R5944:Serpini1 UTSW 3 75640299 missense probably damaging 1.00
R6704:Serpini1 UTSW 3 75637948 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTGCAAAGTGTGGTGACAGG -3'
(R):5'- AATCCATCACAGTTACCTTTTCATG -3'

Sequencing Primer
(F):5'- TGACAGGGGCAACGTTC -3'
(R):5'- CTTAGTTTCACTTCAGCTATGGC -3'
Posted On2016-12-20