Incidental Mutation 'R0547:Jam3'
ID44910
Institutional Source Beutler Lab
Gene Symbol Jam3
Ensembl Gene ENSMUSG00000031990
Gene Namejunction adhesion molecule 3
Synonyms1110002N23Rik, Jcam3, JAM-C, JAM-3
MMRRC Submission 038739-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.513) question?
Stock #R0547 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location27097384-27155421 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27098888 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 267 (Y267H)
Ref Sequence ENSEMBL: ENSMUSP00000034472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034472] [ENSMUST00000073127] [ENSMUST00000086198] [ENSMUST00000216677]
Predicted Effect probably damaging
Transcript: ENSMUST00000034472
AA Change: Y267H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034472
Gene: ENSMUSG00000031990
AA Change: Y267H

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 38 136 2.7e-9 SMART
IGc2 151 226 8.12e-13 SMART
transmembrane domain 245 267 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073127
SMART Domains Protein: ENSMUSP00000072871
Gene: ENSMUSG00000035024

DomainStartEndE-ValueType
low complexity region 159 170 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Pfam:Cnd1 949 1148 1.7e-46 PFAM
low complexity region 1192 1200 N/A INTRINSIC
coiled coil region 1213 1270 N/A INTRINSIC
low complexity region 1290 1315 N/A INTRINSIC
low complexity region 1393 1410 N/A INTRINSIC
low complexity region 1485 1498 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086198
SMART Domains Protein: ENSMUSP00000083374
Gene: ENSMUSG00000035024

DomainStartEndE-ValueType
low complexity region 159 170 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Pfam:Cohesin_HEAT 536 560 4.6e-5 PFAM
Pfam:Cnd1 949 1148 6.6e-59 PFAM
low complexity region 1192 1200 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167074
SMART Domains Protein: ENSMUSP00000128003
Gene: ENSMUSG00000031990

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 18 24 N/A INTRINSIC
IG 38 136 2.7e-9 SMART
Pfam:C2-set_2 138 206 4.8e-7 PFAM
Pfam:Ig_3 139 206 7.1e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215446
Predicted Effect probably benign
Transcript: ENSMUST00000216677
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217654
Meta Mutation Damage Score 0.136 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. The protein encoded by this immunoglobulin superfamily gene member is localized in the tight junctions between high endothelial cells. Unlike other proteins in this family, the this protein is unable to adhere to leukocyte cell lines and only forms weak homotypic interactions. The encoded protein is a member of the junctional adhesion molecule protein family and acts as a receptor for another member of this family. A mutation in an intron of this gene is associated with hemorrhagic destruction of the brain, subependymal calcification, and congenital cataracts. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Apr 2011]
PHENOTYPE: Approximately 60% of mice homozygous for a targeted mutation exhibit postnatal lethality. Males are infertile and display small testes and arrested differentiation of round spermatids into spermatozoa, as shown by the absence of acrosomes, elongated nuclei, and morphological signs of polarization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057N15Rik A G 16: 88,773,610 Y181H probably benign Het
A530084C06Rik A G 13: 31,558,830 probably benign Het
Adamtsl1 A G 4: 86,356,355 D1208G probably benign Het
Ankrd55 T C 13: 112,368,223 F501S probably benign Het
Aox2 G A 1: 58,310,042 D656N probably damaging Het
Atr A T 9: 95,899,165 probably benign Het
Bicra G A 7: 15,972,248 R1423W probably damaging Het
Cabyr T A 18: 12,751,016 S187T probably benign Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Cdon A T 9: 35,457,498 T343S possibly damaging Het
Cep350 C T 1: 155,901,435 probably null Het
Copa T C 1: 172,121,687 probably benign Het
Cyp4f18 T C 8: 71,996,010 D265G probably benign Het
Dgkb T A 12: 38,604,158 C759S probably benign Het
Dnah6 T C 6: 73,044,774 M3470V probably benign Het
Eif4g2 T C 7: 111,078,293 N177S probably damaging Het
Etfb C T 7: 43,454,578 Q145* probably null Het
Flnb T A 14: 7,912,943 probably null Het
G430095P16Rik G A 8: 84,726,642 probably benign Het
Gfral A T 9: 76,208,642 S17T probably benign Het
Gm884 T C 11: 103,620,164 N326S unknown Het
Gpr26 T C 7: 131,984,297 I332T probably benign Het
Greb1 T A 12: 16,723,411 T221S probably benign Het
Haus5 A T 7: 30,659,083 S289T probably damaging Het
Ighv6-4 T C 12: 114,406,601 Y77C probably damaging Het
Il23r A T 6: 67,423,701 D548E probably benign Het
Il23r A T 6: 67,486,251 F86Y possibly damaging Het
Inppl1 A T 7: 101,831,003 M424K probably benign Het
Mms19 A T 19: 41,963,418 M160K probably damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Mup5 A G 4: 61,833,000 L137P probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Ntrk2 G A 13: 58,874,370 S413N probably damaging Het
Nuak2 C A 1: 132,332,203 T573N probably benign Het
Odf3 A G 7: 140,848,815 probably null Het
Olfr651 G A 7: 104,553,356 V146M probably benign Het
Olfr734 A T 14: 50,320,118 I239K probably benign Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pclo T A 5: 14,792,072 I4787N unknown Het
Pde8a G T 7: 81,324,130 V612L probably benign Het
Pear1 A T 3: 87,788,800 probably null Het
Pgbd1 A G 13: 21,423,518 Y169H probably damaging Het
Pkd1l1 A G 11: 8,836,448 probably benign Het
Prkag3 C T 1: 74,744,720 probably null Het
Rsph9 A T 17: 46,144,124 S9T possibly damaging Het
Rxfp1 A T 3: 79,705,569 probably null Het
Senp7 A G 16: 56,175,826 E756G probably damaging Het
Serpina1e G T 12: 103,949,191 T252K probably benign Het
Sipa1l1 T A 12: 82,437,736 S1555T probably benign Het
Slain1 T C 14: 103,695,275 S432P probably damaging Het
Slc37a2 A T 9: 37,233,122 probably null Het
Thg1l C T 11: 45,954,191 R18Q probably damaging Het
Tnn A G 1: 160,116,337 probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Tshz3 A G 7: 36,771,417 T944A probably damaging Het
Ttn C G 2: 76,854,430 probably benign Het
Ythdc2 T C 18: 44,840,264 S323P possibly damaging Het
Zfp827 A G 8: 79,060,310 N35S probably damaging Het
Other mutations in Jam3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Jam3 APN 9 27101892 missense probably damaging 1.00
IGL01311:Jam3 APN 9 27098723 missense probably damaging 0.99
IGL01729:Jam3 APN 9 27105525 missense probably damaging 1.00
IGL03233:Jam3 APN 9 27101921 missense probably damaging 1.00
IGL03275:Jam3 APN 9 27101249 missense probably damaging 0.99
R0267:Jam3 UTSW 9 27106405 missense probably benign 0.01
R0899:Jam3 UTSW 9 27098957 missense probably damaging 1.00
R1499:Jam3 UTSW 9 27106405 missense possibly damaging 0.93
R3926:Jam3 UTSW 9 27106405 missense possibly damaging 0.93
R4044:Jam3 UTSW 9 27101863 critical splice donor site probably null
R4977:Jam3 UTSW 9 27098373 missense probably damaging 0.96
R6527:Jam3 UTSW 9 27155344 missense unknown
R6759:Jam3 UTSW 9 27101980 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AACCCTGAGAGCCACAGAGTTTCC -3'
(R):5'- TAACGGGGCCAAGGTCCTTTGATG -3'

Sequencing Primer
(F):5'- ATACAGAGCACTAGGGTTTCTGC -3'
(R):5'- AAGGTCCTTTGATGGACCAC -3'
Posted On2013-06-11