Incidental Mutation 'R0547:Gfral'
ID44913
Institutional Source Beutler Lab
Gene Symbol Gfral
Ensembl Gene ENSMUSG00000059383
Gene NameGDNF family receptor alpha like
SynonymsGRAL
MMRRC Submission 038739-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R0547 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location76164102-76213657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76208642 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 17 (S17T)
Ref Sequence ENSEMBL: ENSMUSP00000139120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074880] [ENSMUST00000184693]
Predicted Effect probably benign
Transcript: ENSMUST00000074880
AA Change: S17T

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000074421
Gene: ENSMUSG00000059383
AA Change: S17T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
GDNF 24 99 4.05e0 SMART
GDNF 131 210 1.15e-19 SMART
GDNF 220 316 3.15e-17 SMART
transmembrane domain 351 370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184693
AA Change: S17T

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000139120
Gene: ENSMUSG00000059383
AA Change: S17T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
GDNF 24 99 4.05e0 SMART
GDNF 131 210 1.15e-19 SMART
Meta Mutation Damage Score 0.1216 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 98% (57/58)
MGI Phenotype PHENOTYPE: Homozygous knockout leads to increased susceptibility to diet-induced obesity caused by overeating and reduced glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057N15Rik A G 16: 88,773,610 Y181H probably benign Het
A530084C06Rik A G 13: 31,558,830 probably benign Het
Adamtsl1 A G 4: 86,356,355 D1208G probably benign Het
Ankrd55 T C 13: 112,368,223 F501S probably benign Het
Aox2 G A 1: 58,310,042 D656N probably damaging Het
Atr A T 9: 95,899,165 probably benign Het
Bicra G A 7: 15,972,248 R1423W probably damaging Het
Cabyr T A 18: 12,751,016 S187T probably benign Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Cdon A T 9: 35,457,498 T343S possibly damaging Het
Cep350 C T 1: 155,901,435 probably null Het
Copa T C 1: 172,121,687 probably benign Het
Cyp4f18 T C 8: 71,996,010 D265G probably benign Het
Dgkb T A 12: 38,604,158 C759S probably benign Het
Dnah6 T C 6: 73,044,774 M3470V probably benign Het
Eif4g2 T C 7: 111,078,293 N177S probably damaging Het
Etfb C T 7: 43,454,578 Q145* probably null Het
Flnb T A 14: 7,912,943 probably null Het
G430095P16Rik G A 8: 84,726,642 probably benign Het
Gm884 T C 11: 103,620,164 N326S unknown Het
Gpr26 T C 7: 131,984,297 I332T probably benign Het
Greb1 T A 12: 16,723,411 T221S probably benign Het
Haus5 A T 7: 30,659,083 S289T probably damaging Het
Ighv6-4 T C 12: 114,406,601 Y77C probably damaging Het
Il23r A T 6: 67,423,701 D548E probably benign Het
Il23r A T 6: 67,486,251 F86Y possibly damaging Het
Inppl1 A T 7: 101,831,003 M424K probably benign Het
Jam3 A G 9: 27,098,888 Y267H probably damaging Het
Mms19 A T 19: 41,963,418 M160K probably damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Mup5 A G 4: 61,833,000 L137P probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Ntrk2 G A 13: 58,874,370 S413N probably damaging Het
Nuak2 C A 1: 132,332,203 T573N probably benign Het
Odf3 A G 7: 140,848,815 probably null Het
Olfr651 G A 7: 104,553,356 V146M probably benign Het
Olfr734 A T 14: 50,320,118 I239K probably benign Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pclo T A 5: 14,792,072 I4787N unknown Het
Pde8a G T 7: 81,324,130 V612L probably benign Het
Pear1 A T 3: 87,788,800 probably null Het
Pgbd1 A G 13: 21,423,518 Y169H probably damaging Het
Pkd1l1 A G 11: 8,836,448 probably benign Het
Prkag3 C T 1: 74,744,720 probably null Het
Rsph9 A T 17: 46,144,124 S9T possibly damaging Het
Rxfp1 A T 3: 79,705,569 probably null Het
Senp7 A G 16: 56,175,826 E756G probably damaging Het
Serpina1e G T 12: 103,949,191 T252K probably benign Het
Sipa1l1 T A 12: 82,437,736 S1555T probably benign Het
Slain1 T C 14: 103,695,275 S432P probably damaging Het
Slc37a2 A T 9: 37,233,122 probably null Het
Thg1l C T 11: 45,954,191 R18Q probably damaging Het
Tnn A G 1: 160,116,337 probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Tshz3 A G 7: 36,771,417 T944A probably damaging Het
Ttn C G 2: 76,854,430 probably benign Het
Ythdc2 T C 18: 44,840,264 S323P possibly damaging Het
Zfp827 A G 8: 79,060,310 N35S probably damaging Het
Other mutations in Gfral
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Gfral APN 9 76164825 nonsense probably null
IGL02383:Gfral APN 9 76197092 missense probably damaging 0.97
IGL02987:Gfral APN 9 76197301 missense possibly damaging 0.82
IGL03002:Gfral APN 9 76197238 missense possibly damaging 0.61
IGL03055:Gfral UTSW 9 76208549 missense probably benign 0.00
PIT4585001:Gfral UTSW 9 76197294 missense probably damaging 1.00
R0268:Gfral UTSW 9 76197101 missense probably damaging 1.00
R1146:Gfral UTSW 9 76167059 missense probably benign 0.00
R1146:Gfral UTSW 9 76167059 missense probably benign 0.00
R1275:Gfral UTSW 9 76197032 missense probably damaging 1.00
R1830:Gfral UTSW 9 76193203 missense probably benign 0.01
R2249:Gfral UTSW 9 76193349 missense probably damaging 1.00
R3709:Gfral UTSW 9 76193443 nonsense probably null
R4712:Gfral UTSW 9 76193445 missense possibly damaging 0.71
R5567:Gfral UTSW 9 76208618 missense probably benign 0.00
R5568:Gfral UTSW 9 76164805 makesense probably null
R5719:Gfral UTSW 9 76197046 missense probably benign 0.02
R5789:Gfral UTSW 9 76197046 missense probably benign 0.02
R5791:Gfral UTSW 9 76197046 missense probably benign 0.02
R7110:Gfral UTSW 9 76164830 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- ACAATCTCTGCTAGAATCCTGACCCTC -3'
(R):5'- TGGTAAGGCTCCATCTAGTTCCAGTG -3'

Sequencing Primer
(F):5'- GTTTACTGACAATGAGCCAAGTG -3'
(R):5'- CATCTAGTTCCAGTGGTGGGC -3'
Posted On2013-06-11