Incidental Mutation 'R5818:Chrng'
ID449137
Institutional Source Beutler Lab
Gene Symbol Chrng
Ensembl Gene ENSMUSG00000026253
Gene Namecholinergic receptor, nicotinic, gamma polypeptide
SynonymsAcrg, Achr-3
MMRRC Submission 043398-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5818 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location87204657-87212694 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87209801 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 320 (V320I)
Ref Sequence ENSEMBL: ENSMUSP00000027470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027470] [ENSMUST00000050876] [ENSMUST00000076362] [ENSMUST00000113230] [ENSMUST00000113231] [ENSMUST00000113232] [ENSMUST00000113233] [ENSMUST00000113235] [ENSMUST00000123735] [ENSMUST00000185763] [ENSMUST00000186038] [ENSMUST00000188796]
Predicted Effect probably benign
Transcript: ENSMUST00000027470
AA Change: V320I

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027470
Gene: ENSMUSG00000026253
AA Change: V320I

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 26 241 7.9e-72 PFAM
Pfam:Neur_chan_memb 248 494 9.6e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050876
SMART Domains Protein: ENSMUSP00000053403
Gene: ENSMUSG00000026254

DomainStartEndE-ValueType
Pfam:IF4E 55 217 2.4e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076362
SMART Domains Protein: ENSMUSP00000075699
Gene: ENSMUSG00000026254

DomainStartEndE-ValueType
Pfam:IF4E 55 217 4.1e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113230
SMART Domains Protein: ENSMUSP00000108856
Gene: ENSMUSG00000026254

DomainStartEndE-ValueType
Pfam:IF4E 50 212 1.7e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113231
SMART Domains Protein: ENSMUSP00000108857
Gene: ENSMUSG00000026254

DomainStartEndE-ValueType
Pfam:IF4E 50 212 4.4e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113232
SMART Domains Protein: ENSMUSP00000108858
Gene: ENSMUSG00000026254

DomainStartEndE-ValueType
Pfam:IF4E 55 217 4e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113233
SMART Domains Protein: ENSMUSP00000108859
Gene: ENSMUSG00000026254

DomainStartEndE-ValueType
Pfam:IF4E 55 217 8.6e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113235
SMART Domains Protein: ENSMUSP00000108861
Gene: ENSMUSG00000026254

DomainStartEndE-ValueType
Pfam:IF4E 55 217 1.8e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123735
SMART Domains Protein: ENSMUSP00000137771
Gene: ENSMUSG00000026254

DomainStartEndE-ValueType
Pfam:IF4E 50 128 1.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185763
SMART Domains Protein: ENSMUSP00000139600
Gene: ENSMUSG00000026253

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 20 72 1.4e-6 PFAM
Pfam:Neur_chan_LBD 117 255 1e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186038
SMART Domains Protein: ENSMUSP00000141001
Gene: ENSMUSG00000026253

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
Pfam:Neur_chan_LBD 48 220 1e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188796
SMART Domains Protein: ENSMUSP00000140796
Gene: ENSMUSG00000026253

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 26 142 1.3e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189392
Meta Mutation Damage Score 0.216 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mammalian muscle-type acetylcholine receptor is a transmembrane pentameric glycoprotein with two alpha subunits, one beta, one delta, and one epsilon (in adult skeletal muscle) or gamma (in fetal and denervated muscle) subunit. This gene, which encodes the gamma subunit, is expressed prior to the thirty-third week of gestation in humans. The gamma subunit of the acetylcholine receptor plays a role in neuromuscular organogenesis and ligand binding and disruption of gamma subunit expression prevents the correct localization of the receptor in cell membranes. Mutations in this gene cause Escobar syndrome and a lethal form of multiple pterygium syndrome. Muscle-type acetylcholine receptor is the major antigen in the autoimmune disease myasthenia gravis.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice display perinatal and postnatal lethality, paradoxical breathing, abnormal skeletal muscle morphology, abnormal neuromuscular junction morphology and physiology, and are unable to suckle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,219,643 V560D probably damaging Het
Actn4 A G 7: 28,919,019 I72T probably damaging Het
Adam33 A T 2: 131,054,358 C440S possibly damaging Het
Bace1 T C 9: 45,859,049 I361T possibly damaging Het
Bend6 T C 1: 33,883,573 probably benign Het
Bpifb9a T G 2: 154,262,295 N219K probably damaging Het
Cacna1g C A 11: 94,418,120 K1634N probably damaging Het
Ccdc155 C T 7: 45,193,959 probably null Het
Cdk18 A G 1: 132,119,098 probably null Het
Corin G T 5: 72,435,395 H87N probably benign Het
Cps1 A T 1: 67,166,488 I557F possibly damaging Het
Cyp4a29 T C 4: 115,247,032 V99A possibly damaging Het
Dach1 T C 14: 98,168,684 D209G probably damaging Het
Dgat1 G A 15: 76,502,207 probably benign Het
Fbxw26 G T 9: 109,732,566 R187S probably benign Het
Gabrd G A 4: 155,388,361 P122S probably damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm8300 T G 12: 87,517,060 V55G possibly damaging Het
Hif1a A G 12: 73,939,564 Q343R possibly damaging Het
Hyou1 G A 9: 44,388,926 probably null Het
Igfn1 A T 1: 135,966,126 I2072K possibly damaging Het
Kctd8 C T 5: 69,296,711 A328T probably benign Het
Krt10 A G 11: 99,388,771 Y188H probably damaging Het
Krtap4-16 T A 11: 99,851,523 Q17L unknown Het
Larp4b T A 13: 9,158,560 S416R probably benign Het
Lmtk2 G A 5: 144,156,900 V232M probably benign Het
Mroh4 A G 15: 74,611,982 I571T probably damaging Het
Myo15 G A 11: 60,497,951 R2021Q probably benign Het
Npl G A 1: 153,535,915 R63C probably damaging Het
Ntn4 A G 10: 93,644,764 I80V probably benign Het
Numb C T 12: 83,825,254 probably null Het
Nusap1 A C 2: 119,635,513 M205L possibly damaging Het
Olfr149 T C 9: 39,702,365 S135G probably benign Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Pmfbp1 T C 8: 109,538,679 probably null Het
Ppfia1 T C 7: 144,520,568 probably benign Het
Ppm1b A G 17: 84,993,719 K9R probably benign Het
Rab11fip3 T C 17: 26,016,116 S608G probably damaging Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Sohlh2 A G 3: 55,190,501 T125A probably damaging Het
Ssfa2 T A 2: 79,644,593 S299T probably damaging Het
Tet1 C A 10: 62,816,408 M1610I possibly damaging Het
Tgfbr3 A T 5: 107,133,003 D630E probably benign Het
Thnsl2 T C 6: 71,134,143 D247G probably benign Het
Tmem198b G A 10: 128,802,188 R169W probably benign Het
Tmem201 G A 4: 149,727,392 A332V probably benign Het
Tsku T C 7: 98,352,098 D342G possibly damaging Het
Ucn2 A T 9: 108,986,497 H109L probably benign Het
Virma T G 4: 11,513,319 L391R possibly damaging Het
Vmn1r60 T A 7: 5,545,099 M1L probably benign Het
Vmn2r76 T C 7: 86,229,934 H386R probably benign Het
Zfp608 C T 18: 54,895,396 R1315Q probably benign Het
Zmym2 A G 14: 56,946,529 T983A probably benign Het
Zscan26 A G 13: 21,445,761 S65P probably benign Het
Other mutations in Chrng
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Chrng APN 1 87206747 missense probably damaging 0.99
IGL02947:Chrng APN 1 87209884 unclassified probably null
IGL03014:Chrng UTSW 1 87211037 critical splice donor site probably null
R1051:Chrng UTSW 1 87209063 missense possibly damaging 0.70
R1346:Chrng UTSW 1 87208263 missense probably benign 0.09
R1368:Chrng UTSW 1 87205853 missense probably damaging 1.00
R1588:Chrng UTSW 1 87207507 missense probably damaging 1.00
R1703:Chrng UTSW 1 87210906 missense possibly damaging 0.63
R2852:Chrng UTSW 1 87206706 missense probably benign 0.01
R3707:Chrng UTSW 1 87210611 nonsense probably null
R4780:Chrng UTSW 1 87207524 missense probably damaging 1.00
R5871:Chrng UTSW 1 87206729 missense possibly damaging 0.95
R6058:Chrng UTSW 1 87211352 missense probably damaging 1.00
R6136:Chrng UTSW 1 87209801 missense probably benign 0.45
R7086:Chrng UTSW 1 87211013 missense probably benign 0.06
R7229:Chrng UTSW 1 87209444 missense probably benign 0.27
T0975:Chrng UTSW 1 87210626 missense probably benign 0.00
X0063:Chrng UTSW 1 87206706 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGCCCATAGCCTTGCTAAGC -3'
(R):5'- CATTTGGCATAGATTTGCAGCTG -3'

Sequencing Primer
(F):5'- TTGCTAAGCAAGAGGGCTAAATCC -3'
(R):5'- GCATAGATTTGCAGCTGAATTTGAG -3'
Posted On2016-12-20