Incidental Mutation 'R0547:Atr'
ID44914
Institutional Source Beutler Lab
Gene Symbol Atr
Ensembl Gene ENSMUSG00000032409
Gene Nameataxia telangiectasia and Rad3 related
Synonyms
MMRRC Submission 038739-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0547 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location95857597-95951781 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 95899165 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034980] [ENSMUST00000215311]
Predicted Effect probably benign
Transcript: ENSMUST00000034980
SMART Domains Protein: ENSMUSP00000034980
Gene: ENSMUSG00000032409

DomainStartEndE-ValueType
low complexity region 431 449 N/A INTRINSIC
low complexity region 889 897 N/A INTRINSIC
low complexity region 998 1013 N/A INTRINSIC
UME 1119 1225 2.3e-43 SMART
low complexity region 1352 1362 N/A INTRINSIC
Pfam:FAT 1771 2092 9.2e-51 PFAM
PI3Kc 2320 2630 7.51e-124 SMART
FATC 2609 2641 6.22e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188164
Predicted Effect probably benign
Transcript: ENSMUST00000215311
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs the PI3/PI4-kinase family, and is most closely related to ATM, a protein kinase encoded by the gene mutated in ataxia telangiectasia. This protein and ATM share similarity with Schizosaccharomyces pombe rad3, a cell cycle checkpoint gene required for cell cycle arrest and DNA damage repair in response to DNA damage. This kinase has been shown to phosphorylate checkpoint kinase CHK1, checkpoint proteins RAD17, and RAD9, as well as tumor suppressor protein BRCA1. Mutations of this gene are associated with Seckel syndrome. An alternatively spliced transcript variant of this gene has been reported, however, its full length nature is not known. Transcript variants utilizing alternative polyA sites exist. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice heterozygous for a knock-out allele exhibit premature death and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057N15Rik A G 16: 88,773,610 Y181H probably benign Het
A530084C06Rik A G 13: 31,558,830 probably benign Het
Adamtsl1 A G 4: 86,356,355 D1208G probably benign Het
Ankrd55 T C 13: 112,368,223 F501S probably benign Het
Aox2 G A 1: 58,310,042 D656N probably damaging Het
Bicra G A 7: 15,972,248 R1423W probably damaging Het
Cabyr T A 18: 12,751,016 S187T probably benign Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Cdon A T 9: 35,457,498 T343S possibly damaging Het
Cep350 C T 1: 155,901,435 probably null Het
Copa T C 1: 172,121,687 probably benign Het
Cyp4f18 T C 8: 71,996,010 D265G probably benign Het
Dgkb T A 12: 38,604,158 C759S probably benign Het
Dnah6 T C 6: 73,044,774 M3470V probably benign Het
Eif4g2 T C 7: 111,078,293 N177S probably damaging Het
Etfb C T 7: 43,454,578 Q145* probably null Het
Flnb T A 14: 7,912,943 probably null Het
G430095P16Rik G A 8: 84,726,642 probably benign Het
Gfral A T 9: 76,208,642 S17T probably benign Het
Gm884 T C 11: 103,620,164 N326S unknown Het
Gpr26 T C 7: 131,984,297 I332T probably benign Het
Greb1 T A 12: 16,723,411 T221S probably benign Het
Haus5 A T 7: 30,659,083 S289T probably damaging Het
Ighv6-4 T C 12: 114,406,601 Y77C probably damaging Het
Il23r A T 6: 67,423,701 D548E probably benign Het
Il23r A T 6: 67,486,251 F86Y possibly damaging Het
Inppl1 A T 7: 101,831,003 M424K probably benign Het
Jam3 A G 9: 27,098,888 Y267H probably damaging Het
Mms19 A T 19: 41,963,418 M160K probably damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Mup5 A G 4: 61,833,000 L137P probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Ntrk2 G A 13: 58,874,370 S413N probably damaging Het
Nuak2 C A 1: 132,332,203 T573N probably benign Het
Odf3 A G 7: 140,848,815 probably null Het
Olfr651 G A 7: 104,553,356 V146M probably benign Het
Olfr734 A T 14: 50,320,118 I239K probably benign Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pclo T A 5: 14,792,072 I4787N unknown Het
Pde8a G T 7: 81,324,130 V612L probably benign Het
Pear1 A T 3: 87,788,800 probably null Het
Pgbd1 A G 13: 21,423,518 Y169H probably damaging Het
Pkd1l1 A G 11: 8,836,448 probably benign Het
Prkag3 C T 1: 74,744,720 probably null Het
Rsph9 A T 17: 46,144,124 S9T possibly damaging Het
Rxfp1 A T 3: 79,705,569 probably null Het
Senp7 A G 16: 56,175,826 E756G probably damaging Het
Serpina1e G T 12: 103,949,191 T252K probably benign Het
Sipa1l1 T A 12: 82,437,736 S1555T probably benign Het
Slain1 T C 14: 103,695,275 S432P probably damaging Het
Slc37a2 A T 9: 37,233,122 probably null Het
Thg1l C T 11: 45,954,191 R18Q probably damaging Het
Tnn A G 1: 160,116,337 probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Tshz3 A G 7: 36,771,417 T944A probably damaging Het
Ttn C G 2: 76,854,430 probably benign Het
Ythdc2 T C 18: 44,840,264 S323P possibly damaging Het
Zfp827 A G 8: 79,060,310 N35S probably damaging Het
Other mutations in Atr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Atr APN 9 95865052 missense probably damaging 1.00
IGL00922:Atr APN 9 95907345 missense probably damaging 0.97
IGL01020:Atr APN 9 95862783 missense probably damaging 1.00
IGL01345:Atr APN 9 95940949 missense probably damaging 1.00
IGL01364:Atr APN 9 95865624 missense probably benign 0.29
IGL01456:Atr APN 9 95950565 missense possibly damaging 0.62
IGL01534:Atr APN 9 95865546 missense probably damaging 0.99
IGL01761:Atr APN 9 95951448 splice site probably benign
IGL01791:Atr APN 9 95921781 missense probably benign 0.05
IGL01831:Atr APN 9 95870754 missense probably benign 0.18
IGL01973:Atr APN 9 95871674 missense probably damaging 1.00
IGL02008:Atr APN 9 95881420 splice site probably benign
IGL02016:Atr APN 9 95927175 missense probably benign 0.09
IGL02035:Atr APN 9 95866682 missense probably benign 0.01
IGL02058:Atr APN 9 95871487 missense probably damaging 0.99
IGL02081:Atr APN 9 95883205 missense probably damaging 1.00
IGL02224:Atr APN 9 95878629 missense probably damaging 0.98
IGL02234:Atr APN 9 95947250 splice site probably benign
IGL02367:Atr APN 9 95899141 nonsense probably null
IGL02621:Atr APN 9 95908400 missense probably benign 0.00
IGL02728:Atr APN 9 95936475 missense probably damaging 1.00
IGL02833:Atr APN 9 95862852 missense probably damaging 1.00
IGL02939:Atr APN 9 95865261 missense probably benign
IGL03107:Atr APN 9 95897730 missense probably benign 0.28
IGL03382:Atr APN 9 95920822 nonsense probably null
PIT4812001:Atr UTSW 9 95910649 missense probably benign 0.41
R0042:Atr UTSW 9 95927356 splice site probably benign
R0042:Atr UTSW 9 95927356 splice site probably benign
R0281:Atr UTSW 9 95937566 missense probably benign 0.26
R0282:Atr UTSW 9 95862798 missense probably benign 0.12
R0512:Atr UTSW 9 95935526 missense probably damaging 0.99
R0567:Atr UTSW 9 95865829 missense probably benign 0.00
R0631:Atr UTSW 9 95874777 missense possibly damaging 0.92
R1116:Atr UTSW 9 95867636 nonsense probably null
R1171:Atr UTSW 9 95907323 missense probably damaging 1.00
R1241:Atr UTSW 9 95950636 missense probably benign 0.08
R1345:Atr UTSW 9 95920355 missense probably benign 0.25
R1400:Atr UTSW 9 95862848 missense probably benign 0.32
R1413:Atr UTSW 9 95932442 missense probably damaging 1.00
R1527:Atr UTSW 9 95870043 missense possibly damaging 0.82
R1557:Atr UTSW 9 95871449 missense probably damaging 1.00
R1591:Atr UTSW 9 95945385 missense probably damaging 1.00
R1602:Atr UTSW 9 95951557 missense probably damaging 1.00
R1605:Atr UTSW 9 95936463 missense probably damaging 1.00
R1670:Atr UTSW 9 95861456 missense probably benign 0.38
R1709:Atr UTSW 9 95871076 missense probably benign 0.00
R1728:Atr UTSW 9 95897581 missense probably benign 0.01
R1729:Atr UTSW 9 95897581 missense probably benign 0.01
R1739:Atr UTSW 9 95897581 missense probably benign 0.01
R1816:Atr UTSW 9 95866694 missense probably benign 0.00
R1824:Atr UTSW 9 95936421 missense probably damaging 1.00
R1844:Atr UTSW 9 95905817 missense probably benign 0.01
R1857:Atr UTSW 9 95865097 missense probably damaging 1.00
R1858:Atr UTSW 9 95865097 missense probably damaging 1.00
R1866:Atr UTSW 9 95870605 splice site probably null
R1913:Atr UTSW 9 95866733 missense probably benign 0.01
R2042:Atr UTSW 9 95870022 missense probably benign 0.00
R2210:Atr UTSW 9 95907300 missense probably damaging 1.00
R2230:Atr UTSW 9 95920765 missense probably damaging 1.00
R2361:Atr UTSW 9 95871157 missense probably benign 0.41
R2399:Atr UTSW 9 95871599 missense probably benign 0.00
R2431:Atr UTSW 9 95862892 missense probably benign 0.24
R2860:Atr UTSW 9 95874243 missense probably benign 0.07
R2861:Atr UTSW 9 95874243 missense probably benign 0.07
R3019:Atr UTSW 9 95905818 missense possibly damaging 0.52
R3684:Atr UTSW 9 95920400 missense probably damaging 0.96
R4155:Atr UTSW 9 95888124 nonsense probably null
R4295:Atr UTSW 9 95874426 missense probably benign 0.04
R4359:Atr UTSW 9 95951536 missense probably damaging 1.00
R4506:Atr UTSW 9 95865237 missense probably benign 0.21
R4523:Atr UTSW 9 95862863 missense probably damaging 1.00
R4536:Atr UTSW 9 95874418 missense probably benign 0.26
R4588:Atr UTSW 9 95865667 missense probably benign
R4646:Atr UTSW 9 95871197 critical splice donor site probably null
R4702:Atr UTSW 9 95920355 missense possibly damaging 0.92
R4743:Atr UTSW 9 95862792 missense probably benign 0.14
R4782:Atr UTSW 9 95862797 missense probably benign 0.00
R4928:Atr UTSW 9 95907299 missense probably damaging 1.00
R5031:Atr UTSW 9 95865702 missense probably damaging 0.98
R5138:Atr UTSW 9 95937596 missense probably benign 0.15
R5188:Atr UTSW 9 95921725 missense probably benign 0.00
R5219:Atr UTSW 9 95881238 missense probably damaging 0.99
R5307:Atr UTSW 9 95878544 missense probably benign 0.01
R5414:Atr UTSW 9 95870704 missense probably benign 0.00
R5628:Atr UTSW 9 95874226 nonsense probably null
R5664:Atr UTSW 9 95905813 missense probably benign 0.00
R5678:Atr UTSW 9 95951487 nonsense probably null
R5724:Atr UTSW 9 95866588 missense probably damaging 1.00
R5759:Atr UTSW 9 95874402 missense probably benign 0.01
R5763:Atr UTSW 9 95945123 missense probably benign 0.04
R5922:Atr UTSW 9 95903682 missense probably benign 0.00
R6051:Atr UTSW 9 95908369 missense possibly damaging 0.85
R6161:Atr UTSW 9 95865319 missense probably benign
R6171:Atr UTSW 9 95881271 nonsense probably null
R6532:Atr UTSW 9 95908408 missense probably benign
R6774:Atr UTSW 9 95927213 missense probably benign 0.00
R6894:Atr UTSW 9 95927197 missense probably damaging 1.00
R6930:Atr UTSW 9 95866635 missense probably benign 0.21
R7018:Atr UTSW 9 95866694 missense probably benign 0.17
R7056:Atr UTSW 9 95862863 missense probably damaging 1.00
R7103:Atr UTSW 9 95865372 missense probably damaging 0.98
R7154:Atr UTSW 9 95865045 missense probably benign
R7157:Atr UTSW 9 95869900 missense probably benign 0.00
R7188:Atr UTSW 9 95862791 nonsense probably null
R7189:Atr UTSW 9 95862791 nonsense probably null
R7300:Atr UTSW 9 95865370 missense probably benign 0.00
X0019:Atr UTSW 9 95940871 missense probably damaging 1.00
Z1088:Atr UTSW 9 95885320 intron probably null
Predicted Primers PCR Primer
(F):5'- GATACCAGCTCAGTTTGACTTCACTCTC -3'
(R):5'- GCAACAATGTGATGGGTTTCATTATGGC -3'

Sequencing Primer
(F):5'- TAAACTCACTGTGGGTGGCAC -3'
(R):5'- GATGGGTTTCATTATGGCATTTTG -3'
Posted On2013-06-11