Incidental Mutation 'R5818:Gabrd'
ID449152
Institutional Source Beutler Lab
Gene Symbol Gabrd
Ensembl Gene ENSMUSG00000029054
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit delta
Synonyms
MMRRC Submission 043398-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R5818 (G1)
Quality Score169
Status Validated
Chromosome4
Chromosomal Location155384980-155398112 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 155388361 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 122 (P122S)
Ref Sequence ENSEMBL: ENSMUSP00000030925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030925]
Predicted Effect probably damaging
Transcript: ENSMUST00000030925
AA Change: P122S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030925
Gene: ENSMUSG00000029054
AA Change: P122S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Neur_chan_LBD 43 247 9.8e-48 PFAM
Pfam:Neur_chan_memb 254 402 6.5e-34 PFAM
transmembrane domain 426 448 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150423
Meta Mutation Damage Score 0.796 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. The GABA-A receptor is generally pentameric and there are five types of subunits: alpha, beta, gamma, delta, and rho. This gene encodes the delta subunit. Mutations in this gene have been associated with susceptibility to generalized epilepsy with febrile seizures, type 5. Alternatively spliced transcript variants have been described for this gene, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased postpartum depression and anxiety behaviors, lethality of pups due to materal neglect, and increased cued and contextual conditional freezing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,219,643 V560D probably damaging Het
Actn4 A G 7: 28,919,019 I72T probably damaging Het
Adam33 A T 2: 131,054,358 C440S possibly damaging Het
Bace1 T C 9: 45,859,049 I361T possibly damaging Het
Bend6 T C 1: 33,883,573 probably benign Het
Bpifb9a T G 2: 154,262,295 N219K probably damaging Het
Cacna1g C A 11: 94,418,120 K1634N probably damaging Het
Ccdc155 C T 7: 45,193,959 probably null Het
Cdk18 A G 1: 132,119,098 probably null Het
Chrng G A 1: 87,209,801 V320I probably benign Het
Corin G T 5: 72,435,395 H87N probably benign Het
Cps1 A T 1: 67,166,488 I557F possibly damaging Het
Cyp4a29 T C 4: 115,247,032 V99A possibly damaging Het
Dach1 T C 14: 98,168,684 D209G probably damaging Het
Dgat1 G A 15: 76,502,207 probably benign Het
Fbxw26 G T 9: 109,732,566 R187S probably benign Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm8300 T G 12: 87,517,060 V55G possibly damaging Het
Hif1a A G 12: 73,939,564 Q343R possibly damaging Het
Hyou1 G A 9: 44,388,926 probably null Het
Igfn1 A T 1: 135,966,126 I2072K possibly damaging Het
Kctd8 C T 5: 69,296,711 A328T probably benign Het
Krt10 A G 11: 99,388,771 Y188H probably damaging Het
Krtap4-16 T A 11: 99,851,523 Q17L unknown Het
Larp4b T A 13: 9,158,560 S416R probably benign Het
Lmtk2 G A 5: 144,156,900 V232M probably benign Het
Mroh4 A G 15: 74,611,982 I571T probably damaging Het
Myo15 G A 11: 60,497,951 R2021Q probably benign Het
Npl G A 1: 153,535,915 R63C probably damaging Het
Ntn4 A G 10: 93,644,764 I80V probably benign Het
Numb C T 12: 83,825,254 probably null Het
Nusap1 A C 2: 119,635,513 M205L possibly damaging Het
Olfr149 T C 9: 39,702,365 S135G probably benign Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Pmfbp1 T C 8: 109,538,679 probably null Het
Ppfia1 T C 7: 144,520,568 probably benign Het
Ppm1b A G 17: 84,993,719 K9R probably benign Het
Rab11fip3 T C 17: 26,016,116 S608G probably damaging Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Sohlh2 A G 3: 55,190,501 T125A probably damaging Het
Ssfa2 T A 2: 79,644,593 S299T probably damaging Het
Tet1 C A 10: 62,816,408 M1610I possibly damaging Het
Tgfbr3 A T 5: 107,133,003 D630E probably benign Het
Thnsl2 T C 6: 71,134,143 D247G probably benign Het
Tmem198b G A 10: 128,802,188 R169W probably benign Het
Tmem201 G A 4: 149,727,392 A332V probably benign Het
Tsku T C 7: 98,352,098 D342G possibly damaging Het
Ucn2 A T 9: 108,986,497 H109L probably benign Het
Virma T G 4: 11,513,319 L391R possibly damaging Het
Vmn1r60 T A 7: 5,545,099 M1L probably benign Het
Vmn2r76 T C 7: 86,229,934 H386R probably benign Het
Zfp608 C T 18: 54,895,396 R1315Q probably benign Het
Zmym2 A G 14: 56,946,529 T983A probably benign Het
Zscan26 A G 13: 21,445,761 S65P probably benign Het
Other mutations in Gabrd
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0006:Gabrd UTSW 4 155388601 missense probably damaging 1.00
R0006:Gabrd UTSW 4 155388601 missense probably damaging 1.00
R0569:Gabrd UTSW 4 155385423 missense probably damaging 1.00
R1826:Gabrd UTSW 4 155386486 missense probably damaging 1.00
R4387:Gabrd UTSW 4 155388932 critical splice donor site probably null
R5071:Gabrd UTSW 4 155387162 missense probably damaging 1.00
R5650:Gabrd UTSW 4 155388624 missense probably damaging 1.00
R6045:Gabrd UTSW 4 155386474 missense possibly damaging 0.82
R6301:Gabrd UTSW 4 155387267 missense probably damaging 0.96
R7064:Gabrd UTSW 4 155388346 missense probably damaging 1.00
R7146:Gabrd UTSW 4 155385406 missense probably benign
R7426:Gabrd UTSW 4 155385513 missense possibly damaging 0.81
R7451:Gabrd UTSW 4 155388459 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- ACTGGCTACCATCATGTATCTG -3'
(R):5'- TCAATCGGCTCTCTGGGTTG -3'

Sequencing Primer
(F):5'- GCTACCATCATGTATCTGTGTGG -3'
(R):5'- CTCTCTGGGTTGTGTGCCATC -3'
Posted On2016-12-20