Incidental Mutation 'R5818:Thnsl2'
ID449157
Institutional Source Beutler Lab
Gene Symbol Thnsl2
Ensembl Gene ENSMUSG00000054474
Gene Namethreonine synthase-like 2 (bacterial)
SynonymsTSH2
MMRRC Submission 043398-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R5818 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location71128166-71144439 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71134143 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 247 (D247G)
Ref Sequence ENSEMBL: ENSMUSP00000124423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074241] [ENSMUST00000160918]
Predicted Effect probably benign
Transcript: ENSMUST00000074241
AA Change: D247G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000073861
Gene: ENSMUSG00000054474
AA Change: D247G

DomainStartEndE-ValueType
Pfam:Thr_synth_N 2 81 2.4e-27 PFAM
Pfam:PALP 93 415 9.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160918
AA Change: D247G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000124423
Gene: ENSMUSG00000054474
AA Change: D247G

DomainStartEndE-ValueType
Pfam:Thr_synth_N 2 81 1.1e-27 PFAM
Pfam:PALP 94 413 8.4e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170455
Predicted Effect probably benign
Transcript: ENSMUST00000170753
SMART Domains Protein: ENSMUSP00000129994
Gene: ENSMUSG00000054474

DomainStartEndE-ValueType
PDB:4F4F|B 2 122 1e-11 PDB
SCOP:d1kl7a_ 2 129 1e-10 SMART
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a threonine synthase-like protein. A similar enzyme in mouse can catalyze the degradation of O-phospho-homoserine to a-ketobutyrate, phosphate, and ammonia. This protein also has phospho-lyase activity on both gamma and beta phosphorylated substrates. In mouse an alternatively spliced form of this protein has been shown to act as a cytokine and can induce the production of the inflammatory cytokine IL6 in osteoblasts. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,219,643 V560D probably damaging Het
Actn4 A G 7: 28,919,019 I72T probably damaging Het
Adam33 A T 2: 131,054,358 C440S possibly damaging Het
Bace1 T C 9: 45,859,049 I361T possibly damaging Het
Bend6 T C 1: 33,883,573 probably benign Het
Bpifb9a T G 2: 154,262,295 N219K probably damaging Het
Cacna1g C A 11: 94,418,120 K1634N probably damaging Het
Ccdc155 C T 7: 45,193,959 probably null Het
Cdk18 A G 1: 132,119,098 probably null Het
Chrng G A 1: 87,209,801 V320I probably benign Het
Corin G T 5: 72,435,395 H87N probably benign Het
Cps1 A T 1: 67,166,488 I557F possibly damaging Het
Cyp4a29 T C 4: 115,247,032 V99A possibly damaging Het
Dach1 T C 14: 98,168,684 D209G probably damaging Het
Dgat1 G A 15: 76,502,207 probably benign Het
Fbxw26 G T 9: 109,732,566 R187S probably benign Het
Gabrd G A 4: 155,388,361 P122S probably damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm8300 T G 12: 87,517,060 V55G possibly damaging Het
Hif1a A G 12: 73,939,564 Q343R possibly damaging Het
Hyou1 G A 9: 44,388,926 probably null Het
Igfn1 A T 1: 135,966,126 I2072K possibly damaging Het
Kctd8 C T 5: 69,296,711 A328T probably benign Het
Krt10 A G 11: 99,388,771 Y188H probably damaging Het
Krtap4-16 T A 11: 99,851,523 Q17L unknown Het
Larp4b T A 13: 9,158,560 S416R probably benign Het
Lmtk2 G A 5: 144,156,900 V232M probably benign Het
Mroh4 A G 15: 74,611,982 I571T probably damaging Het
Myo15 G A 11: 60,497,951 R2021Q probably benign Het
Npl G A 1: 153,535,915 R63C probably damaging Het
Ntn4 A G 10: 93,644,764 I80V probably benign Het
Numb C T 12: 83,825,254 probably null Het
Nusap1 A C 2: 119,635,513 M205L possibly damaging Het
Olfr149 T C 9: 39,702,365 S135G probably benign Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Pmfbp1 T C 8: 109,538,679 probably null Het
Ppfia1 T C 7: 144,520,568 probably benign Het
Ppm1b A G 17: 84,993,719 K9R probably benign Het
Rab11fip3 T C 17: 26,016,116 S608G probably damaging Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Sohlh2 A G 3: 55,190,501 T125A probably damaging Het
Ssfa2 T A 2: 79,644,593 S299T probably damaging Het
Tet1 C A 10: 62,816,408 M1610I possibly damaging Het
Tgfbr3 A T 5: 107,133,003 D630E probably benign Het
Tmem198b G A 10: 128,802,188 R169W probably benign Het
Tmem201 G A 4: 149,727,392 A332V probably benign Het
Tsku T C 7: 98,352,098 D342G possibly damaging Het
Ucn2 A T 9: 108,986,497 H109L probably benign Het
Virma T G 4: 11,513,319 L391R possibly damaging Het
Vmn1r60 T A 7: 5,545,099 M1L probably benign Het
Vmn2r76 T C 7: 86,229,934 H386R probably benign Het
Zfp608 C T 18: 54,895,396 R1315Q probably benign Het
Zmym2 A G 14: 56,946,529 T983A probably benign Het
Zscan26 A G 13: 21,445,761 S65P probably benign Het
Other mutations in Thnsl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Thnsl2 APN 6 71131900 missense probably damaging 1.00
IGL00814:Thnsl2 APN 6 71139883 missense probably damaging 1.00
IGL01139:Thnsl2 APN 6 71138734 missense probably damaging 1.00
IGL01380:Thnsl2 APN 6 71138756 missense probably benign
IGL01511:Thnsl2 APN 6 71139793 missense probably benign 0.04
IGL02000:Thnsl2 APN 6 71134219 missense probably damaging 1.00
IGL03157:Thnsl2 APN 6 71131946 missense probably benign 0.00
R0372:Thnsl2 UTSW 6 71139790 missense probably damaging 1.00
R0380:Thnsl2 UTSW 6 71141330 missense probably damaging 1.00
R0521:Thnsl2 UTSW 6 71134259 missense probably damaging 1.00
R0815:Thnsl2 UTSW 6 71134224 nonsense probably null
R0863:Thnsl2 UTSW 6 71134224 nonsense probably null
R1300:Thnsl2 UTSW 6 71134191 missense probably damaging 1.00
R2867:Thnsl2 UTSW 6 71131961 missense probably damaging 1.00
R2867:Thnsl2 UTSW 6 71131961 missense probably damaging 1.00
R4767:Thnsl2 UTSW 6 71134295 missense probably damaging 1.00
R5578:Thnsl2 UTSW 6 71138765 missense probably benign 0.40
R6627:Thnsl2 UTSW 6 71134215 missense possibly damaging 0.70
R6800:Thnsl2 UTSW 6 71141280 missense probably benign 0.29
R7192:Thnsl2 UTSW 6 71139755 missense probably benign 0.02
R7391:Thnsl2 UTSW 6 71131930 missense probably damaging 1.00
X0021:Thnsl2 UTSW 6 71128704 missense probably benign 0.02
X0066:Thnsl2 UTSW 6 71139837 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTGAGCCTTGAGTTCTGTC -3'
(R):5'- TCTGGTGCTGAGAGATACCC -3'

Sequencing Primer
(F):5'- CTACTAGGGGTTGTGCAAGCAC -3'
(R):5'- TGCTGAGAGATACCCGCTTC -3'
Posted On2016-12-20