Incidental Mutation 'R0547:Thg1l'
ID44916
Institutional Source Beutler Lab
Gene Symbol Thg1l
Ensembl Gene ENSMUSG00000011254
Gene NametRNA-histidine guanylyltransferase 1-like (S. cerevisiae)
Synonyms5730409G07Rik, 1700121M19Rik
MMRRC Submission 038739-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0547 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location45946843-45955494 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45954191 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 18 (R18Q)
Ref Sequence ENSEMBL: ENSMUSP00000104877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011398] [ENSMUST00000109254]
Predicted Effect probably damaging
Transcript: ENSMUST00000011398
AA Change: R78Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000011398
Gene: ENSMUSG00000011254
AA Change: R78Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Thg1 35 164 1e-53 PFAM
Pfam:Thg1C 167 283 2.6e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109254
AA Change: R18Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104877
Gene: ENSMUSG00000011254
AA Change: R18Q

DomainStartEndE-ValueType
Pfam:Thg1 2 104 2.1e-37 PFAM
Pfam:Thg1C 105 235 6.5e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133851
Meta Mutation Damage Score 0.0408 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mitochondrial protein that is induced by high levels of glucose and is associated with diabetic nephropathy. The encoded protein appears to increase mitochondrial biogenesis, which could lead to renal fibrosis. Another function of this protein is that of a guanyltransferase, adding GMP to the 5' end of tRNA(His). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057N15Rik A G 16: 88,773,610 Y181H probably benign Het
A530084C06Rik A G 13: 31,558,830 probably benign Het
Adamtsl1 A G 4: 86,356,355 D1208G probably benign Het
Ankrd55 T C 13: 112,368,223 F501S probably benign Het
Aox2 G A 1: 58,310,042 D656N probably damaging Het
Atr A T 9: 95,899,165 probably benign Het
Bicra G A 7: 15,972,248 R1423W probably damaging Het
Cabyr T A 18: 12,751,016 S187T probably benign Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Cdon A T 9: 35,457,498 T343S possibly damaging Het
Cep350 C T 1: 155,901,435 probably null Het
Copa T C 1: 172,121,687 probably benign Het
Cyp4f18 T C 8: 71,996,010 D265G probably benign Het
Dgkb T A 12: 38,604,158 C759S probably benign Het
Dnah6 T C 6: 73,044,774 M3470V probably benign Het
Eif4g2 T C 7: 111,078,293 N177S probably damaging Het
Etfb C T 7: 43,454,578 Q145* probably null Het
Flnb T A 14: 7,912,943 probably null Het
G430095P16Rik G A 8: 84,726,642 probably benign Het
Gfral A T 9: 76,208,642 S17T probably benign Het
Gm884 T C 11: 103,620,164 N326S unknown Het
Gpr26 T C 7: 131,984,297 I332T probably benign Het
Greb1 T A 12: 16,723,411 T221S probably benign Het
Haus5 A T 7: 30,659,083 S289T probably damaging Het
Ighv6-4 T C 12: 114,406,601 Y77C probably damaging Het
Il23r A T 6: 67,486,251 F86Y possibly damaging Het
Il23r A T 6: 67,423,701 D548E probably benign Het
Inppl1 A T 7: 101,831,003 M424K probably benign Het
Jam3 A G 9: 27,098,888 Y267H probably damaging Het
Mms19 A T 19: 41,963,418 M160K probably damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Mup5 A G 4: 61,833,000 L137P probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Ntrk2 G A 13: 58,874,370 S413N probably damaging Het
Nuak2 C A 1: 132,332,203 T573N probably benign Het
Odf3 A G 7: 140,848,815 probably null Het
Olfr651 G A 7: 104,553,356 V146M probably benign Het
Olfr734 A T 14: 50,320,118 I239K probably benign Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pclo T A 5: 14,792,072 I4787N unknown Het
Pde8a G T 7: 81,324,130 V612L probably benign Het
Pear1 A T 3: 87,788,800 probably null Het
Pgbd1 A G 13: 21,423,518 Y169H probably damaging Het
Pkd1l1 A G 11: 8,836,448 probably benign Het
Prkag3 C T 1: 74,744,720 probably null Het
Rsph9 A T 17: 46,144,124 S9T possibly damaging Het
Rxfp1 A T 3: 79,705,569 probably null Het
Senp7 A G 16: 56,175,826 E756G probably damaging Het
Serpina1e G T 12: 103,949,191 T252K probably benign Het
Sipa1l1 T A 12: 82,437,736 S1555T probably benign Het
Slain1 T C 14: 103,695,275 S432P probably damaging Het
Slc37a2 A T 9: 37,233,122 probably null Het
Tnn A G 1: 160,116,337 probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Tshz3 A G 7: 36,771,417 T944A probably damaging Het
Ttn C G 2: 76,854,430 probably benign Het
Ythdc2 T C 18: 44,840,264 S323P possibly damaging Het
Zfp827 A G 8: 79,060,310 N35S probably damaging Het
Other mutations in Thg1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Thg1l APN 11 45954221 missense probably benign 0.02
IGL01111:Thg1l APN 11 45948224 missense probably damaging 0.98
IGL01899:Thg1l APN 11 45954191 missense probably damaging 0.96
IGL02097:Thg1l APN 11 45950228 missense probably benign 0.09
IGL02746:Thg1l APN 11 45948227 nonsense probably null
R1099:Thg1l UTSW 11 45954161 missense possibly damaging 0.76
R1998:Thg1l UTSW 11 45950203 missense possibly damaging 0.95
R2568:Thg1l UTSW 11 45951565 missense probably benign
R4738:Thg1l UTSW 11 45954191 missense probably damaging 1.00
R5614:Thg1l UTSW 11 45950227 missense possibly damaging 0.65
R6191:Thg1l UTSW 11 45954161 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCAGCATCACCCACAACTTTGAG -3'
(R):5'- TCACAGAAAAGTGGATTGAAGCCTAGC -3'

Sequencing Primer
(F):5'- CACAACTTTGAGGATCTCAGC -3'
(R):5'- gctgtcctccttgtttttcttg -3'
Posted On2013-06-11