Incidental Mutation 'R5818:Ccdc155'
ID449160
Institutional Source Beutler Lab
Gene Symbol Ccdc155
Ensembl Gene ENSMUSG00000038292
Gene Namecoiled-coil domain containing 155
SynonymsKASH5, LOC384619
MMRRC Submission 043398-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5818 (G1)
Quality Score167
Status Validated
Chromosome7
Chromosomal Location45183624-45204892 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 45193959 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121017] [ENSMUST00000121017] [ENSMUST00000121017]
Predicted Effect probably null
Transcript: ENSMUST00000121017
SMART Domains Protein: ENSMUSP00000113616
Gene: ENSMUSG00000038292

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Pfam:EF-hand_9 108 175 8e-31 PFAM
Pfam:KASH_CCD 227 419 2.4e-90 PFAM
low complexity region 472 498 N/A INTRINSIC
low complexity region 607 633 N/A INTRINSIC
low complexity region 638 647 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121017
SMART Domains Protein: ENSMUSP00000113616
Gene: ENSMUSG00000038292

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Pfam:EF-hand_9 108 175 8e-31 PFAM
Pfam:KASH_CCD 227 419 2.4e-90 PFAM
low complexity region 472 498 N/A INTRINSIC
low complexity region 607 633 N/A INTRINSIC
low complexity region 638 647 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121017
SMART Domains Protein: ENSMUSP00000113616
Gene: ENSMUSG00000038292

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Pfam:EF-hand_9 108 175 8e-31 PFAM
Pfam:KASH_CCD 227 419 2.4e-90 PFAM
low complexity region 472 498 N/A INTRINSIC
low complexity region 607 633 N/A INTRINSIC
low complexity region 638 647 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211277
Meta Mutation Damage Score 0.65 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Homozygous null mice are infertile. Females have small ovaries and lack ovarian follicles. Males exhibit small testes and seminiferous tubules, lack of mature sperm, increased testis apoptosis, and meiotic arrest along with limited homologous chromosome pairing and unresolved double-strand breaks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,219,643 V560D probably damaging Het
Actn4 A G 7: 28,919,019 I72T probably damaging Het
Adam33 A T 2: 131,054,358 C440S possibly damaging Het
Bace1 T C 9: 45,859,049 I361T possibly damaging Het
Bend6 T C 1: 33,883,573 probably benign Het
Bpifb9a T G 2: 154,262,295 N219K probably damaging Het
Cacna1g C A 11: 94,418,120 K1634N probably damaging Het
Cdk18 A G 1: 132,119,098 probably null Het
Chrng G A 1: 87,209,801 V320I probably benign Het
Corin G T 5: 72,435,395 H87N probably benign Het
Cps1 A T 1: 67,166,488 I557F possibly damaging Het
Cyp4a29 T C 4: 115,247,032 V99A possibly damaging Het
Dach1 T C 14: 98,168,684 D209G probably damaging Het
Dgat1 G A 15: 76,502,207 probably benign Het
Fbxw26 G T 9: 109,732,566 R187S probably benign Het
Gabrd G A 4: 155,388,361 P122S probably damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm8300 T G 12: 87,517,060 V55G possibly damaging Het
Hif1a A G 12: 73,939,564 Q343R possibly damaging Het
Hyou1 G A 9: 44,388,926 probably null Het
Igfn1 A T 1: 135,966,126 I2072K possibly damaging Het
Kctd8 C T 5: 69,296,711 A328T probably benign Het
Krt10 A G 11: 99,388,771 Y188H probably damaging Het
Krtap4-16 T A 11: 99,851,523 Q17L unknown Het
Larp4b T A 13: 9,158,560 S416R probably benign Het
Lmtk2 G A 5: 144,156,900 V232M probably benign Het
Mroh4 A G 15: 74,611,982 I571T probably damaging Het
Myo15 G A 11: 60,497,951 R2021Q probably benign Het
Npl G A 1: 153,535,915 R63C probably damaging Het
Ntn4 A G 10: 93,644,764 I80V probably benign Het
Numb C T 12: 83,825,254 probably null Het
Nusap1 A C 2: 119,635,513 M205L possibly damaging Het
Olfr149 T C 9: 39,702,365 S135G probably benign Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Pmfbp1 T C 8: 109,538,679 probably null Het
Ppfia1 T C 7: 144,520,568 probably benign Het
Ppm1b A G 17: 84,993,719 K9R probably benign Het
Rab11fip3 T C 17: 26,016,116 S608G probably damaging Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Sohlh2 A G 3: 55,190,501 T125A probably damaging Het
Ssfa2 T A 2: 79,644,593 S299T probably damaging Het
Tet1 C A 10: 62,816,408 M1610I possibly damaging Het
Tgfbr3 A T 5: 107,133,003 D630E probably benign Het
Thnsl2 T C 6: 71,134,143 D247G probably benign Het
Tmem198b G A 10: 128,802,188 R169W probably benign Het
Tmem201 G A 4: 149,727,392 A332V probably benign Het
Tsku T C 7: 98,352,098 D342G possibly damaging Het
Ucn2 A T 9: 108,986,497 H109L probably benign Het
Virma T G 4: 11,513,319 L391R possibly damaging Het
Vmn1r60 T A 7: 5,545,099 M1L probably benign Het
Vmn2r76 T C 7: 86,229,934 H386R probably benign Het
Zfp608 C T 18: 54,895,396 R1315Q probably benign Het
Zmym2 A G 14: 56,946,529 T983A probably benign Het
Zscan26 A G 13: 21,445,761 S65P probably benign Het
Other mutations in Ccdc155
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Ccdc155 APN 7 45185306 missense possibly damaging 0.72
IGL01120:Ccdc155 APN 7 45184198 missense probably damaging 0.99
IGL01620:Ccdc155 APN 7 45189960 missense probably damaging 0.98
IGL01643:Ccdc155 APN 7 45200286 missense probably damaging 0.99
IGL02528:Ccdc155 APN 7 45183746 unclassified probably benign
PIT4585001:Ccdc155 UTSW 7 45200271 missense probably benign 0.02
R0240:Ccdc155 UTSW 7 45200251 missense probably benign 0.43
R1219:Ccdc155 UTSW 7 45189408 splice site probably benign
R1768:Ccdc155 UTSW 7 45188803 intron probably null
R5155:Ccdc155 UTSW 7 45189654 nonsense probably null
R6746:Ccdc155 UTSW 7 45200311 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CATGGGCCATACAGCAAAGG -3'
(R):5'- CCACCTAAGGAAGCTATGGG -3'

Sequencing Primer
(F):5'- CATACAGCAAAGGAAGAAAGGGGTAC -3'
(R):5'- AGACCCTTGCTGTCCTCAGG -3'
Posted On2016-12-20