Incidental Mutation 'R5818:Hyou1'
ID 449166
Institutional Source Beutler Lab
Gene Symbol Hyou1
Ensembl Gene ENSMUSG00000032115
Gene Name hypoxia up-regulated 1
Synonyms 140 kDa, Orp150, Cab140, Grp170, CBP-140
MMRRC Submission 043398-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5818 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 44290840-44303662 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 44300223 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066601] [ENSMUST00000159473] [ENSMUST00000160902] [ENSMUST00000160902] [ENSMUST00000161318] [ENSMUST00000161318] [ENSMUST00000162560]
AlphaFold Q9JKR6
Predicted Effect probably null
Transcript: ENSMUST00000066601
SMART Domains Protein: ENSMUSP00000068594
Gene: ENSMUSG00000032115

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 669 1.3e-101 PFAM
Pfam:HSP70 690 814 2.1e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159473
SMART Domains Protein: ENSMUSP00000124177
Gene: ENSMUSG00000032115

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:HSP70 38 226 2e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160112
Predicted Effect probably null
Transcript: ENSMUST00000160902
SMART Domains Protein: ENSMUSP00000125594
Gene: ENSMUSG00000032115

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 671 3.8e-101 PFAM
Pfam:HSP70 690 814 1.2e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000160902
SMART Domains Protein: ENSMUSP00000125594
Gene: ENSMUSG00000032115

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 671 3.8e-101 PFAM
Pfam:HSP70 690 814 1.2e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161147
Predicted Effect probably null
Transcript: ENSMUST00000161318
SMART Domains Protein: ENSMUSP00000123700
Gene: ENSMUSG00000032115

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 671 3.8e-101 PFAM
Pfam:HSP70 690 814 1.2e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161318
SMART Domains Protein: ENSMUSP00000123700
Gene: ENSMUSG00000032115

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 671 3.8e-101 PFAM
Pfam:HSP70 690 814 1.2e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161537
Predicted Effect probably benign
Transcript: ENSMUST00000162560
SMART Domains Protein: ENSMUSP00000123749
Gene: ENSMUSG00000032115

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 168 6.5e-20 PFAM
Meta Mutation Damage Score 0.9511 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the heat shock protein 70 family. This gene uses alternative transcription start sites. A cis-acting segment found in the 5' UTR is involved in stress-dependent induction, resulting in the accumulation of this protein in the endoplasmic reticulum (ER) under hypoxic conditions. The protein encoded by this gene is thought to play an important role in protein folding and secretion in the ER. Since suppression of the protein is associated with accelerated apoptosis, it is also suggested to have an important cytoprotective role in hypoxia-induced cellular perturbation. This protein has been shown to be up-regulated in tumors, especially in breast tumors, and thus it is associated with tumor invasiveness. This gene also has an alternative translation initiation site, resulting in a protein that lacks the N-terminal signal peptide. This signal peptide-lacking protein, which is only 3 amino acids shorter than the mature protein in the ER, is thought to have a housekeeping function in the cytosol. In rat, this protein localizes to both the ER by a carboxy-terminal peptide sequence and to mitochondria by an amino-terminal targeting signal. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice display embryonic lethality. Heterozygous mice display increased susceptibility to induced neuronal cell death. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Gene trapped(5)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,110,469 (GRCm39) V560D probably damaging Het
Actn4 A G 7: 28,618,444 (GRCm39) I72T probably damaging Het
Adam33 A T 2: 130,896,278 (GRCm39) C440S possibly damaging Het
Bace1 T C 9: 45,770,347 (GRCm39) I361T possibly damaging Het
Bend6 T C 1: 33,922,654 (GRCm39) probably benign Het
Bpifb9a T G 2: 154,104,215 (GRCm39) N219K probably damaging Het
Cacna1g C A 11: 94,308,946 (GRCm39) K1634N probably damaging Het
Cdk18 A G 1: 132,046,836 (GRCm39) probably null Het
Chrng G A 1: 87,137,523 (GRCm39) V320I probably benign Het
Corin G T 5: 72,592,738 (GRCm39) H87N probably benign Het
Cps1 A T 1: 67,205,647 (GRCm39) I557F possibly damaging Het
Cyp4a29 T C 4: 115,104,229 (GRCm39) V99A possibly damaging Het
Dach1 T C 14: 98,406,120 (GRCm39) D209G probably damaging Het
Dgat1 G A 15: 76,386,407 (GRCm39) probably benign Het
Eif1ad8 T G 12: 87,563,830 (GRCm39) V55G possibly damaging Het
Fbxw26 G T 9: 109,561,634 (GRCm39) R187S probably benign Het
Gabrd G A 4: 155,472,818 (GRCm39) P122S probably damaging Het
Gm11677 C T 11: 111,615,537 (GRCm39) noncoding transcript Het
Hif1a A G 12: 73,986,338 (GRCm39) Q343R possibly damaging Het
Igfn1 A T 1: 135,893,864 (GRCm39) I2072K possibly damaging Het
Itprid2 T A 2: 79,474,937 (GRCm39) S299T probably damaging Het
Kash5 C T 7: 44,843,383 (GRCm39) probably null Het
Kctd8 C T 5: 69,454,054 (GRCm39) A328T probably benign Het
Krt10 A G 11: 99,279,597 (GRCm39) Y188H probably damaging Het
Krtap4-16 T A 11: 99,742,349 (GRCm39) Q17L unknown Het
Larp4b T A 13: 9,208,596 (GRCm39) S416R probably benign Het
Lmtk2 G A 5: 144,093,718 (GRCm39) V232M probably benign Het
Mroh4 A G 15: 74,483,831 (GRCm39) I571T probably damaging Het
Myo15a G A 11: 60,388,777 (GRCm39) R2021Q probably benign Het
Npl G A 1: 153,411,661 (GRCm39) R63C probably damaging Het
Ntn4 A G 10: 93,480,626 (GRCm39) I80V probably benign Het
Numb C T 12: 83,872,028 (GRCm39) probably null Het
Nusap1 A C 2: 119,465,994 (GRCm39) M205L possibly damaging Het
Onecut2 T A 18: 64,474,046 (GRCm39) M180K possibly damaging Het
Or10d1b T C 9: 39,613,661 (GRCm39) S135G probably benign Het
Pmfbp1 T C 8: 110,265,311 (GRCm39) probably null Het
Ppfia1 T C 7: 144,074,305 (GRCm39) probably benign Het
Ppm1b A G 17: 85,301,147 (GRCm39) K9R probably benign Het
Rab11fip3 T C 17: 26,235,090 (GRCm39) S608G probably damaging Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 (GRCm39) probably benign Het
Sohlh2 A G 3: 55,097,922 (GRCm39) T125A probably damaging Het
Tet1 C A 10: 62,652,187 (GRCm39) M1610I possibly damaging Het
Tgfbr3 A T 5: 107,280,869 (GRCm39) D630E probably benign Het
Thnsl2 T C 6: 71,111,127 (GRCm39) D247G probably benign Het
Tmem198b G A 10: 128,638,057 (GRCm39) R169W probably benign Het
Tmem201 G A 4: 149,811,849 (GRCm39) A332V probably benign Het
Tsku T C 7: 98,001,305 (GRCm39) D342G possibly damaging Het
Ucn2 A T 9: 108,815,565 (GRCm39) H109L probably benign Het
Virma T G 4: 11,513,319 (GRCm39) L391R possibly damaging Het
Vmn1r60 T A 7: 5,548,098 (GRCm39) M1L probably benign Het
Vmn2r76 T C 7: 85,879,142 (GRCm39) H386R probably benign Het
Zfp608 C T 18: 55,028,468 (GRCm39) R1315Q probably benign Het
Zmym2 A G 14: 57,183,986 (GRCm39) T983A probably benign Het
Zscan26 A G 13: 21,629,931 (GRCm39) S65P probably benign Het
Other mutations in Hyou1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Hyou1 APN 9 44,296,443 (GRCm39) missense probably benign 0.02
IGL01660:Hyou1 APN 9 44,292,414 (GRCm39) missense possibly damaging 0.75
IGL01677:Hyou1 APN 9 44,293,309 (GRCm39) missense probably benign 0.21
IGL01903:Hyou1 APN 9 44,292,438 (GRCm39) splice site probably benign
IGL02636:Hyou1 APN 9 44,292,707 (GRCm39) critical splice donor site probably null
IGL02806:Hyou1 APN 9 44,300,180 (GRCm39) nonsense probably null
IGL03401:Hyou1 APN 9 44,296,206 (GRCm39) missense probably damaging 1.00
IGL03410:Hyou1 APN 9 44,299,355 (GRCm39) missense probably benign
ANU74:Hyou1 UTSW 9 44,292,560 (GRCm39) missense possibly damaging 0.79
D3080:Hyou1 UTSW 9 44,295,774 (GRCm39) missense probably damaging 0.97
PIT4378001:Hyou1 UTSW 9 44,302,148 (GRCm39) missense probably benign 0.26
R0408:Hyou1 UTSW 9 44,295,989 (GRCm39) missense probably damaging 1.00
R0422:Hyou1 UTSW 9 44,300,539 (GRCm39) missense probably damaging 1.00
R1116:Hyou1 UTSW 9 44,295,978 (GRCm39) missense probably damaging 1.00
R1581:Hyou1 UTSW 9 44,300,167 (GRCm39) missense probably damaging 1.00
R1640:Hyou1 UTSW 9 44,300,703 (GRCm39) missense probably benign 0.02
R1803:Hyou1 UTSW 9 44,295,479 (GRCm39) nonsense probably null
R2060:Hyou1 UTSW 9 44,292,849 (GRCm39) missense probably benign 0.28
R2180:Hyou1 UTSW 9 44,299,316 (GRCm39) missense probably benign 0.30
R2233:Hyou1 UTSW 9 44,300,388 (GRCm39) missense probably benign 0.44
R2235:Hyou1 UTSW 9 44,300,388 (GRCm39) missense probably benign 0.44
R3950:Hyou1 UTSW 9 44,296,524 (GRCm39) missense probably damaging 1.00
R4198:Hyou1 UTSW 9 44,300,156 (GRCm39) missense probably damaging 1.00
R4200:Hyou1 UTSW 9 44,300,156 (GRCm39) missense probably damaging 1.00
R4363:Hyou1 UTSW 9 44,291,912 (GRCm39) splice site probably null
R4393:Hyou1 UTSW 9 44,293,169 (GRCm39) missense probably damaging 1.00
R4394:Hyou1 UTSW 9 44,293,169 (GRCm39) missense probably damaging 1.00
R4812:Hyou1 UTSW 9 44,298,418 (GRCm39) intron probably benign
R5239:Hyou1 UTSW 9 44,296,560 (GRCm39) missense possibly damaging 0.96
R5648:Hyou1 UTSW 9 44,296,546 (GRCm39) missense probably damaging 0.99
R5856:Hyou1 UTSW 9 44,292,641 (GRCm39) missense probably damaging 1.00
R6431:Hyou1 UTSW 9 44,293,322 (GRCm39) critical splice donor site probably null
R6594:Hyou1 UTSW 9 44,300,619 (GRCm39) missense probably benign
R6596:Hyou1 UTSW 9 44,299,052 (GRCm39) missense probably benign 0.00
R6613:Hyou1 UTSW 9 44,293,795 (GRCm39) missense probably damaging 0.99
R6704:Hyou1 UTSW 9 44,292,431 (GRCm39) critical splice donor site probably null
R6849:Hyou1 UTSW 9 44,298,561 (GRCm39) missense probably damaging 0.99
R7494:Hyou1 UTSW 9 44,300,706 (GRCm39) missense probably benign 0.04
R7632:Hyou1 UTSW 9 44,292,433 (GRCm39) splice site probably null
R7711:Hyou1 UTSW 9 44,295,759 (GRCm39) missense possibly damaging 0.91
R8064:Hyou1 UTSW 9 44,296,882 (GRCm39) missense possibly damaging 0.80
R8287:Hyou1 UTSW 9 44,299,430 (GRCm39) missense probably benign 0.26
R9352:Hyou1 UTSW 9 44,300,926 (GRCm39) critical splice donor site probably null
R9385:Hyou1 UTSW 9 44,292,812 (GRCm39) missense probably benign 0.06
X0027:Hyou1 UTSW 9 44,302,153 (GRCm39) missense possibly damaging 0.89
Z1176:Hyou1 UTSW 9 44,299,039 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGCTCCTGCTGCACTTCAG -3'
(R):5'- GTCCAGTTACAAATGACAAGAGC -3'

Sequencing Primer
(F):5'- CTGCACTTCAGCCCTCC -3'
(R):5'- CAAGAGCTTACCCAGGTGTCATTG -3'
Posted On 2016-12-20