Incidental Mutation 'R5818:Dach1'
ID449187
Institutional Source Beutler Lab
Gene Symbol Dach1
Ensembl Gene ENSMUSG00000055639
Gene Namedachshund family transcription factor 1
SynonymsDac, E130112M23Rik
MMRRC Submission 043398-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5818 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location97786853-98169765 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98168684 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 209 (D209G)
Ref Sequence ENSEMBL: ENSMUSP00000071464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069334] [ENSMUST00000071533]
Predicted Effect probably damaging
Transcript: ENSMUST00000069334
AA Change: D209G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064970
Gene: ENSMUSG00000055639
AA Change: D209G

DomainStartEndE-ValueType
low complexity region 7 53 N/A INTRINSIC
low complexity region 61 97 N/A INTRINSIC
low complexity region 102 156 N/A INTRINSIC
Pfam:Ski_Sno 159 275 4.8e-53 PFAM
low complexity region 318 334 N/A INTRINSIC
low complexity region 443 470 N/A INTRINSIC
SCOP:d1eq1a_ 556 674 1e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000071533
AA Change: D209G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071464
Gene: ENSMUSG00000055639
AA Change: D209G

DomainStartEndE-ValueType
low complexity region 7 53 N/A INTRINSIC
low complexity region 61 97 N/A INTRINSIC
low complexity region 102 156 N/A INTRINSIC
Pfam:Ski_Sno 164 274 6.5e-42 PFAM
low complexity region 318 334 N/A INTRINSIC
low complexity region 495 522 N/A INTRINSIC
SCOP:d1eq1a_ 608 726 6e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156684
Meta Mutation Damage Score 0.238 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a chromatin-associated protein that associates with other DNA-binding transcription factors to regulate gene expression and cell fate determination during development. The protein contains a Ski domain that is highly conserved from Drosophila to human. Expression of this gene is lost in some forms of metastatic cancer, and is correlated with poor prognosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: In spite of normal gross morphology, mice homozygous for targeted mutations that inactivate this gene die within 1 day of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,219,643 V560D probably damaging Het
Actn4 A G 7: 28,919,019 I72T probably damaging Het
Adam33 A T 2: 131,054,358 C440S possibly damaging Het
Bace1 T C 9: 45,859,049 I361T possibly damaging Het
Bend6 T C 1: 33,883,573 probably benign Het
Bpifb9a T G 2: 154,262,295 N219K probably damaging Het
Cacna1g C A 11: 94,418,120 K1634N probably damaging Het
Ccdc155 C T 7: 45,193,959 probably null Het
Cdk18 A G 1: 132,119,098 probably null Het
Chrng G A 1: 87,209,801 V320I probably benign Het
Corin G T 5: 72,435,395 H87N probably benign Het
Cps1 A T 1: 67,166,488 I557F possibly damaging Het
Cyp4a29 T C 4: 115,247,032 V99A possibly damaging Het
Dgat1 G A 15: 76,502,207 probably benign Het
Fbxw26 G T 9: 109,732,566 R187S probably benign Het
Gabrd G A 4: 155,388,361 P122S probably damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm8300 T G 12: 87,517,060 V55G possibly damaging Het
Hif1a A G 12: 73,939,564 Q343R possibly damaging Het
Hyou1 G A 9: 44,388,926 probably null Het
Igfn1 A T 1: 135,966,126 I2072K possibly damaging Het
Kctd8 C T 5: 69,296,711 A328T probably benign Het
Krt10 A G 11: 99,388,771 Y188H probably damaging Het
Krtap4-16 T A 11: 99,851,523 Q17L unknown Het
Larp4b T A 13: 9,158,560 S416R probably benign Het
Lmtk2 G A 5: 144,156,900 V232M probably benign Het
Mroh4 A G 15: 74,611,982 I571T probably damaging Het
Myo15 G A 11: 60,497,951 R2021Q probably benign Het
Npl G A 1: 153,535,915 R63C probably damaging Het
Ntn4 A G 10: 93,644,764 I80V probably benign Het
Numb C T 12: 83,825,254 probably null Het
Nusap1 A C 2: 119,635,513 M205L possibly damaging Het
Olfr149 T C 9: 39,702,365 S135G probably benign Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Pmfbp1 T C 8: 109,538,679 probably null Het
Ppfia1 T C 7: 144,520,568 probably benign Het
Ppm1b A G 17: 84,993,719 K9R probably benign Het
Rab11fip3 T C 17: 26,016,116 S608G probably damaging Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Sohlh2 A G 3: 55,190,501 T125A probably damaging Het
Ssfa2 T A 2: 79,644,593 S299T probably damaging Het
Tet1 C A 10: 62,816,408 M1610I possibly damaging Het
Tgfbr3 A T 5: 107,133,003 D630E probably benign Het
Thnsl2 T C 6: 71,134,143 D247G probably benign Het
Tmem198b G A 10: 128,802,188 R169W probably benign Het
Tmem201 G A 4: 149,727,392 A332V probably benign Het
Tsku T C 7: 98,352,098 D342G possibly damaging Het
Ucn2 A T 9: 108,986,497 H109L probably benign Het
Virma T G 4: 11,513,319 L391R possibly damaging Het
Vmn1r60 T A 7: 5,545,099 M1L probably benign Het
Vmn2r76 T C 7: 86,229,934 H386R probably benign Het
Zfp608 C T 18: 54,895,396 R1315Q probably benign Het
Zmym2 A G 14: 56,946,529 T983A probably benign Het
Zscan26 A G 13: 21,445,761 S65P probably benign Het
Other mutations in Dach1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Dach1 APN 14 97901422 missense possibly damaging 0.83
IGL01101:Dach1 APN 14 97840204 missense possibly damaging 0.83
IGL02033:Dach1 APN 14 97901429 missense possibly damaging 0.82
IGL02116:Dach1 APN 14 97901423 missense probably damaging 0.98
IGL02583:Dach1 APN 14 97828394 splice site probably benign
IGL02937:Dach1 APN 14 97915795 critical splice donor site probably null
IGL03120:Dach1 APN 14 97827789 missense probably damaging 1.00
R0016:Dach1 UTSW 14 98168748 missense probably damaging 1.00
R0017:Dach1 UTSW 14 98168748 missense probably damaging 1.00
R0117:Dach1 UTSW 14 98168748 missense probably damaging 1.00
R0334:Dach1 UTSW 14 98168748 missense probably damaging 1.00
R0336:Dach1 UTSW 14 98168748 missense probably damaging 1.00
R0371:Dach1 UTSW 14 97969903 missense probably damaging 0.99
R0511:Dach1 UTSW 14 97901329 missense possibly damaging 0.94
R0538:Dach1 UTSW 14 97903279 missense possibly damaging 0.80
R0799:Dach1 UTSW 14 98168615 missense possibly damaging 0.79
R0928:Dach1 UTSW 14 97915832 missense probably damaging 0.98
R0939:Dach1 UTSW 14 97915924 missense probably damaging 0.99
R1512:Dach1 UTSW 14 97901399 missense probably damaging 0.99
R1646:Dach1 UTSW 14 98169114 missense unknown
R1865:Dach1 UTSW 14 97840209 missense possibly damaging 0.68
R1881:Dach1 UTSW 14 97901396 missense probably benign 0.20
R1909:Dach1 UTSW 14 97901393 missense probably damaging 1.00
R1980:Dach1 UTSW 14 97831341 missense probably damaging 1.00
R2215:Dach1 UTSW 14 98168481 critical splice donor site probably null
R2570:Dach1 UTSW 14 97901411 missense probably benign 0.17
R3924:Dach1 UTSW 14 97915903 missense probably damaging 1.00
R3957:Dach1 UTSW 14 97840109 missense probably damaging 0.99
R4095:Dach1 UTSW 14 97901379 missense possibly damaging 0.92
R4373:Dach1 UTSW 14 97827750 missense possibly damaging 0.94
R5350:Dach1 UTSW 14 97969959 missense probably damaging 1.00
R5428:Dach1 UTSW 14 98169269 missense unknown
R6824:Dach1 UTSW 14 98018892 missense possibly damaging 0.81
R6967:Dach1 UTSW 14 97903197 missense probably damaging 1.00
R7263:Dach1 UTSW 14 98168859 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGGTCTCGAAGTCCTTCCTG -3'
(R):5'- GGAGCCCATTGCCTCTTCTG -3'

Sequencing Primer
(F):5'- CCTGGAGATGAGTTTGCAGC -3'
(R):5'- CAGCAGTAGCAGCAGCAGC -3'
Posted On2016-12-20