Incidental Mutation 'R5818:Mroh4'
ID449188
Institutional Source Beutler Lab
Gene Symbol Mroh4
Ensembl Gene ENSMUSG00000022603
Gene Namemaestro heat-like repeat family member 4
Synonyms1700016M24Rik
MMRRC Submission 043398-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5818 (G1)
Quality Score214
Status Validated
Chromosome15
Chromosomal Location74606029-74636353 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74611982 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 571 (I571T)
Ref Sequence ENSEMBL: ENSMUSP00000023271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023271] [ENSMUST00000137963]
Predicted Effect probably damaging
Transcript: ENSMUST00000023271
AA Change: I571T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023271
Gene: ENSMUSG00000022603
AA Change: I571T

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 326 337 N/A INTRINSIC
low complexity region 428 435 N/A INTRINSIC
low complexity region 520 534 N/A INTRINSIC
low complexity region 572 591 N/A INTRINSIC
SCOP:d1ee4a_ 709 852 3e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000137963
AA Change: I502T

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117011
Gene: ENSMUSG00000022603
AA Change: I502T

DomainStartEndE-ValueType
low complexity region 257 268 N/A INTRINSIC
low complexity region 359 366 N/A INTRINSIC
low complexity region 451 465 N/A INTRINSIC
low complexity region 503 522 N/A INTRINSIC
SCOP:d1ee4a_ 640 783 3e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176592
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177179
Meta Mutation Damage Score 0.0276 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,219,643 V560D probably damaging Het
Actn4 A G 7: 28,919,019 I72T probably damaging Het
Adam33 A T 2: 131,054,358 C440S possibly damaging Het
Bace1 T C 9: 45,859,049 I361T possibly damaging Het
Bend6 T C 1: 33,883,573 probably benign Het
Bpifb9a T G 2: 154,262,295 N219K probably damaging Het
Cacna1g C A 11: 94,418,120 K1634N probably damaging Het
Ccdc155 C T 7: 45,193,959 probably null Het
Cdk18 A G 1: 132,119,098 probably null Het
Chrng G A 1: 87,209,801 V320I probably benign Het
Corin G T 5: 72,435,395 H87N probably benign Het
Cps1 A T 1: 67,166,488 I557F possibly damaging Het
Cyp4a29 T C 4: 115,247,032 V99A possibly damaging Het
Dach1 T C 14: 98,168,684 D209G probably damaging Het
Dgat1 G A 15: 76,502,207 probably benign Het
Fbxw26 G T 9: 109,732,566 R187S probably benign Het
Gabrd G A 4: 155,388,361 P122S probably damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm8300 T G 12: 87,517,060 V55G possibly damaging Het
Hif1a A G 12: 73,939,564 Q343R possibly damaging Het
Hyou1 G A 9: 44,388,926 probably null Het
Igfn1 A T 1: 135,966,126 I2072K possibly damaging Het
Kctd8 C T 5: 69,296,711 A328T probably benign Het
Krt10 A G 11: 99,388,771 Y188H probably damaging Het
Krtap4-16 T A 11: 99,851,523 Q17L unknown Het
Larp4b T A 13: 9,158,560 S416R probably benign Het
Lmtk2 G A 5: 144,156,900 V232M probably benign Het
Myo15 G A 11: 60,497,951 R2021Q probably benign Het
Npl G A 1: 153,535,915 R63C probably damaging Het
Ntn4 A G 10: 93,644,764 I80V probably benign Het
Numb C T 12: 83,825,254 probably null Het
Nusap1 A C 2: 119,635,513 M205L possibly damaging Het
Olfr149 T C 9: 39,702,365 S135G probably benign Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Pmfbp1 T C 8: 109,538,679 probably null Het
Ppfia1 T C 7: 144,520,568 probably benign Het
Ppm1b A G 17: 84,993,719 K9R probably benign Het
Rab11fip3 T C 17: 26,016,116 S608G probably damaging Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Sohlh2 A G 3: 55,190,501 T125A probably damaging Het
Ssfa2 T A 2: 79,644,593 S299T probably damaging Het
Tet1 C A 10: 62,816,408 M1610I possibly damaging Het
Tgfbr3 A T 5: 107,133,003 D630E probably benign Het
Thnsl2 T C 6: 71,134,143 D247G probably benign Het
Tmem198b G A 10: 128,802,188 R169W probably benign Het
Tmem201 G A 4: 149,727,392 A332V probably benign Het
Tsku T C 7: 98,352,098 D342G possibly damaging Het
Ucn2 A T 9: 108,986,497 H109L probably benign Het
Virma T G 4: 11,513,319 L391R possibly damaging Het
Vmn1r60 T A 7: 5,545,099 M1L probably benign Het
Vmn2r76 T C 7: 86,229,934 H386R probably benign Het
Zfp608 C T 18: 54,895,396 R1315Q probably benign Het
Zmym2 A G 14: 56,946,529 T983A probably benign Het
Zscan26 A G 13: 21,445,761 S65P probably benign Het
Other mutations in Mroh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01645:Mroh4 APN 15 74611358 splice site probably benign
IGL02370:Mroh4 APN 15 74625541 missense probably benign 0.00
IGL02598:Mroh4 APN 15 74611243 critical splice donor site probably null
IGL02644:Mroh4 APN 15 74610375 missense possibly damaging 0.90
IGL02666:Mroh4 APN 15 74609775 missense probably benign 0.04
IGL02723:Mroh4 APN 15 74608237 splice site probably benign
IGL02724:Mroh4 APN 15 74606151 missense probably benign 0.00
IGL03000:Mroh4 APN 15 74616114 missense probably benign
IGL03103:Mroh4 APN 15 74616159 missense possibly damaging 0.47
IGL03194:Mroh4 APN 15 74611539 missense probably damaging 1.00
R0013:Mroh4 UTSW 15 74608237 splice site probably benign
R0042:Mroh4 UTSW 15 74610305 missense probably damaging 0.99
R0042:Mroh4 UTSW 15 74610305 missense probably damaging 0.99
R0294:Mroh4 UTSW 15 74606149 missense probably benign
R0346:Mroh4 UTSW 15 74614292 splice site probably benign
R0545:Mroh4 UTSW 15 74625427 missense probably benign 0.00
R0688:Mroh4 UTSW 15 74606678 missense probably damaging 0.98
R1838:Mroh4 UTSW 15 74616113 missense probably benign 0.03
R2037:Mroh4 UTSW 15 74609761 missense possibly damaging 0.91
R4725:Mroh4 UTSW 15 74616107 missense probably damaging 0.99
R4786:Mroh4 UTSW 15 74610234 missense probably benign 0.08
R4798:Mroh4 UTSW 15 74626179 missense probably damaging 1.00
R4945:Mroh4 UTSW 15 74612008 missense probably benign 0.00
R5065:Mroh4 UTSW 15 74628270 splice site probably null
R5476:Mroh4 UTSW 15 74611661 missense probably benign 0.15
R5509:Mroh4 UTSW 15 74606154 missense probably benign 0.00
R5527:Mroh4 UTSW 15 74615016 missense probably damaging 1.00
R5662:Mroh4 UTSW 15 74625428 missense possibly damaging 0.63
R5861:Mroh4 UTSW 15 74606607 intron probably benign
R5886:Mroh4 UTSW 15 74606447 missense possibly damaging 0.90
R5935:Mroh4 UTSW 15 74621154 missense probably damaging 1.00
R6008:Mroh4 UTSW 15 74625472 nonsense probably null
R6658:Mroh4 UTSW 15 74621129 missense possibly damaging 0.83
R6689:Mroh4 UTSW 15 74612003 missense probably damaging 1.00
R6739:Mroh4 UTSW 15 74609719 missense probably benign 0.10
R6888:Mroh4 UTSW 15 74613249 missense possibly damaging 0.93
R7088:Mroh4 UTSW 15 74626144 missense probably benign 0.25
R7260:Mroh4 UTSW 15 74608129 missense possibly damaging 0.83
R7365:Mroh4 UTSW 15 74610371 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTCTTGGGTCCGTAGCATC -3'
(R):5'- TAGTTGAGCCTCAGAGCTAGTG -3'

Sequencing Primer
(F):5'- CATCAGCATGCTCAGTGAGTG -3'
(R):5'- CCTCAGAGCTAGTGCAAGGATC -3'
Posted On2016-12-20