Incidental Mutation 'R5819:Olfr1275'
ID449202
Institutional Source Beutler Lab
Gene Symbol Olfr1275
Ensembl Gene ENSMUSG00000074966
Gene Nameolfactory receptor 1275
SynonymsGA_x6K02T2Q125-72283260-72282322, MOR245-18
MMRRC Submission 043399-MU
Accession Numbers

Genbank: NM_001011795; MGI: 3031109

Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5819 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location111230360-111235286 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111230959 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 278 (I278N)
Ref Sequence ENSEMBL: ENSMUSP00000150515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028577] [ENSMUST00000099620] [ENSMUST00000216421] [ENSMUST00000217539]
Predicted Effect probably benign
Transcript: ENSMUST00000028577
SMART Domains Protein: ENSMUSP00000028577
Gene: ENSMUSG00000027157

DomainStartEndE-ValueType
ANK 78 107 1.61e-4 SMART
ANK 111 140 3.6e-2 SMART
ANK 144 173 4.89e-4 SMART
ANK 177 206 4.03e-5 SMART
ANK 210 239 8.72e-1 SMART
Blast:ANK 243 272 4e-12 BLAST
low complexity region 460 472 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099620
AA Change: I278N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097215
Gene: ENSMUSG00000074966
AA Change: I278N

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 9.8e-37 PFAM
Pfam:7tm_1 41 287 5.6e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216421
AA Change: I278N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000217539
AA Change: I278N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,048,600 M4863L probably benign Het
Abca4 A T 3: 122,136,981 I1376F probably damaging Het
Aggf1 T C 13: 95,351,621 N673D possibly damaging Het
Avil T C 10: 127,009,998 F372S probably damaging Het
Bod1l T A 5: 41,832,605 E258D probably benign Het
Ccdc129 A T 6: 55,897,891 K275N probably benign Het
Chek1 T A 9: 36,710,405 H420L probably benign Het
Cyfip1 A G 7: 55,879,151 I260M probably damaging Het
Dclk1 G A 3: 55,489,864 V524I probably damaging Het
Efr3b T C 12: 3,992,965 M102V probably benign Het
Erc2 T A 14: 28,141,369 I517N probably damaging Het
Fubp1 T C 3: 152,220,553 I305T probably damaging Het
Galc T A 12: 98,216,261 D443V probably benign Het
Galnt4 T A 10: 99,110,030 I539N probably damaging Het
Gm17093 G T 14: 44,521,529 M169I unknown Het
Gm4858 A G 3: 93,073,732 Y19C probably damaging Het
Htra1 T C 7: 130,981,739 F363S probably damaging Het
Klhdc8b G A 9: 108,451,062 P64S probably benign Het
Kmt2c A G 5: 25,409,132 probably null Het
Mettl21c T G 1: 44,009,722 K222Q probably damaging Het
Mga A C 2: 119,941,263 M1535L possibly damaging Het
Mov10 C T 3: 104,801,512 G395D probably damaging Het
Ms4a10 C A 19: 10,968,690 A26S probably benign Het
Naaladl1 A G 19: 6,109,654 N372D possibly damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
Osmr C A 15: 6,815,787 V833L probably benign Het
Phf14 A G 6: 11,997,252 probably null Het
Pjvk A G 2: 76,658,369 I295V probably benign Het
Plppr4 T A 3: 117,325,864 I299L possibly damaging Het
Prkg1 A G 19: 31,585,672 S110P probably benign Het
Ptprq T A 10: 107,719,883 probably benign Het
Rarb T G 14: 16,443,820 N156T possibly damaging Het
Rgl3 A T 9: 21,981,602 probably null Het
Ruvbl1 A C 6: 88,483,115 probably null Het
S1pr1 G T 3: 115,712,140 C268* probably null Het
Sbk3 T C 7: 4,969,997 D58G probably benign Het
Scgb2b3 T A 7: 31,360,214 H45L possibly damaging Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Soga3 A T 10: 29,197,273 M854L probably benign Het
Tas2r119 T C 15: 32,177,306 L6P probably damaging Het
Tcp11 A T 17: 28,069,236 F339L probably damaging Het
Tmprss5 T A 9: 49,114,479 probably null Het
Trnau1ap A G 4: 132,325,210 probably benign Het
Trp53bp1 G A 2: 121,208,392 R1397* probably null Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Vmn2r13 T A 5: 109,174,100 M244L possibly damaging Het
Zfp777 C T 6: 48,037,588 E395K probably damaging Het
Zfyve27 A G 19: 42,183,496 S156G probably benign Het
Other mutations in Olfr1275
AlleleSourceChrCoordTypePredicted EffectPPH Score
3-1:Olfr1275 UTSW 2 111231463 missense possibly damaging 0.77
R0477:Olfr1275 UTSW 2 111231664 missense probably benign 0.00
R1209:Olfr1275 UTSW 2 111231613 missense probably damaging 1.00
R1780:Olfr1275 UTSW 2 111231698 missense probably benign
R5386:Olfr1275 UTSW 2 111231194 missense probably benign 0.05
R5637:Olfr1275 UTSW 2 111231111 missense probably benign 0.26
R6007:Olfr1275 UTSW 2 111230930 missense probably benign 0.30
R6414:Olfr1275 UTSW 2 111231152 unclassified probably null
R6557:Olfr1275 UTSW 2 111231631 missense probably benign 0.01
R6864:Olfr1275 UTSW 2 111231197 missense probably benign 0.26
R7035:Olfr1275 UTSW 2 111231439 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCCATTACATGAAATGTCTGG -3'
(R):5'- GCTGACAGTGGATTTATTTCTCTC -3'

Sequencing Primer
(F):5'- CCCATTACATGAAATGTCTGGAAGGC -3'
(R):5'- ACAGTGGATTTATTTCTCTCAGTACC -3'
Posted On2016-12-20