Incidental Mutation 'R0547:Ankrd55'
ID44926
Institutional Source Beutler Lab
Gene Symbol Ankrd55
Ensembl Gene ENSMUSG00000049985
Gene Nameankyrin repeat domain 55
SynonymsC030011J08Rik
MMRRC Submission 038739-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R0547 (G1)
Quality Score201
Status Validated
Chromosome13
Chromosomal Location112288451-112384002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112368223 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 501 (F501S)
Ref Sequence ENSEMBL: ENSMUSP00000022275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022275] [ENSMUST00000165593]
Predicted Effect probably benign
Transcript: ENSMUST00000022275
AA Change: F501S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000022275
Gene: ENSMUSG00000049985
AA Change: F501S

DomainStartEndE-ValueType
Blast:ANK 25 54 1e-9 BLAST
ANK 59 88 7.64e-6 SMART
ANK 92 121 4.18e2 SMART
ANK 125 156 4.86e1 SMART
ANK 160 189 5.32e-5 SMART
ANK 193 222 7.59e-1 SMART
ANK 229 257 2.97e2 SMART
ANK 263 292 5.71e-5 SMART
ANK 296 326 1.63e0 SMART
low complexity region 528 543 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165593
AA Change: F473S

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000126199
Gene: ENSMUSG00000049985
AA Change: F473S

DomainStartEndE-ValueType
Blast:ANK 1 26 8e-8 BLAST
ANK 31 60 7.64e-6 SMART
ANK 64 93 4.18e2 SMART
ANK 97 128 4.86e1 SMART
ANK 132 161 5.32e-5 SMART
ANK 165 194 7.59e-1 SMART
ANK 201 229 2.97e2 SMART
ANK 235 264 5.71e-5 SMART
ANK 268 298 1.63e0 SMART
low complexity region 500 515 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224393
Meta Mutation Damage Score 0.04 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057N15Rik A G 16: 88,773,610 Y181H probably benign Het
A530084C06Rik A G 13: 31,558,830 probably benign Het
Adamtsl1 A G 4: 86,356,355 D1208G probably benign Het
Aox2 G A 1: 58,310,042 D656N probably damaging Het
Atr A T 9: 95,899,165 probably benign Het
Bicra G A 7: 15,972,248 R1423W probably damaging Het
Cabyr T A 18: 12,751,016 S187T probably benign Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Cdon A T 9: 35,457,498 T343S possibly damaging Het
Cep350 C T 1: 155,901,435 probably null Het
Copa T C 1: 172,121,687 probably benign Het
Cyp4f18 T C 8: 71,996,010 D265G probably benign Het
Dgkb T A 12: 38,604,158 C759S probably benign Het
Dnah6 T C 6: 73,044,774 M3470V probably benign Het
Eif4g2 T C 7: 111,078,293 N177S probably damaging Het
Etfb C T 7: 43,454,578 Q145* probably null Het
Flnb T A 14: 7,912,943 probably null Het
G430095P16Rik G A 8: 84,726,642 probably benign Het
Gfral A T 9: 76,208,642 S17T probably benign Het
Gm884 T C 11: 103,620,164 N326S unknown Het
Gpr26 T C 7: 131,984,297 I332T probably benign Het
Greb1 T A 12: 16,723,411 T221S probably benign Het
Haus5 A T 7: 30,659,083 S289T probably damaging Het
Ighv6-4 T C 12: 114,406,601 Y77C probably damaging Het
Il23r A T 6: 67,423,701 D548E probably benign Het
Il23r A T 6: 67,486,251 F86Y possibly damaging Het
Inppl1 A T 7: 101,831,003 M424K probably benign Het
Jam3 A G 9: 27,098,888 Y267H probably damaging Het
Mms19 A T 19: 41,963,418 M160K probably damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Mup5 A G 4: 61,833,000 L137P probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Ntrk2 G A 13: 58,874,370 S413N probably damaging Het
Nuak2 C A 1: 132,332,203 T573N probably benign Het
Odf3 A G 7: 140,848,815 probably null Het
Olfr651 G A 7: 104,553,356 V146M probably benign Het
Olfr734 A T 14: 50,320,118 I239K probably benign Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pclo T A 5: 14,792,072 I4787N unknown Het
Pde8a G T 7: 81,324,130 V612L probably benign Het
Pear1 A T 3: 87,788,800 probably null Het
Pgbd1 A G 13: 21,423,518 Y169H probably damaging Het
Pkd1l1 A G 11: 8,836,448 probably benign Het
Prkag3 C T 1: 74,744,720 probably null Het
Rsph9 A T 17: 46,144,124 S9T possibly damaging Het
Rxfp1 A T 3: 79,705,569 probably null Het
Senp7 A G 16: 56,175,826 E756G probably damaging Het
Serpina1e G T 12: 103,949,191 T252K probably benign Het
Sipa1l1 T A 12: 82,437,736 S1555T probably benign Het
Slain1 T C 14: 103,695,275 S432P probably damaging Het
Slc37a2 A T 9: 37,233,122 probably null Het
Thg1l C T 11: 45,954,191 R18Q probably damaging Het
Tnn A G 1: 160,116,337 probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Tshz3 A G 7: 36,771,417 T944A probably damaging Het
Ttn C G 2: 76,854,430 probably benign Het
Ythdc2 T C 18: 44,840,264 S323P possibly damaging Het
Zfp827 A G 8: 79,060,310 N35S probably damaging Het
Other mutations in Ankrd55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Ankrd55 APN 13 112367794 missense probably benign 0.01
IGL01372:Ankrd55 APN 13 112323143 missense probably damaging 1.00
IGL01554:Ankrd55 APN 13 112323067 missense possibly damaging 0.87
IGL01700:Ankrd55 APN 13 112381168 missense probably benign 0.16
IGL02366:Ankrd55 APN 13 112318460 missense probably damaging 1.00
IGL03368:Ankrd55 APN 13 112318556 splice site probably benign
Crescat UTSW 13 112348863 critical splice donor site probably null
I0000:Ankrd55 UTSW 13 112348725 splice site probably benign
R0781:Ankrd55 UTSW 13 112381233 splice site probably benign
R0981:Ankrd55 UTSW 13 112323076 missense possibly damaging 0.78
R1072:Ankrd55 UTSW 13 112348842 missense possibly damaging 0.83
R1469:Ankrd55 UTSW 13 112367926 missense probably benign 0.39
R1469:Ankrd55 UTSW 13 112367926 missense probably benign 0.39
R2187:Ankrd55 UTSW 13 112383505 missense probably benign 0.01
R4430:Ankrd55 UTSW 13 112323183 critical splice donor site probably null
R4753:Ankrd55 UTSW 13 112363475 missense probably benign
R4846:Ankrd55 UTSW 13 112363454 missense probably benign 0.00
R4911:Ankrd55 UTSW 13 112323039 splice site probably null
R4996:Ankrd55 UTSW 13 112356088 missense possibly damaging 0.68
R5007:Ankrd55 UTSW 13 112367932 missense probably benign
R5077:Ankrd55 UTSW 13 112355988 missense probably benign 0.19
R5118:Ankrd55 UTSW 13 112355939 missense probably benign 0.00
R5350:Ankrd55 UTSW 13 112336226 missense probably damaging 1.00
R5367:Ankrd55 UTSW 13 112318502 missense probably damaging 1.00
R5560:Ankrd55 UTSW 13 112383490 missense probably benign
R5888:Ankrd55 UTSW 13 112355919 missense possibly damaging 0.62
R6130:Ankrd55 UTSW 13 112318446 missense probably damaging 1.00
R6589:Ankrd55 UTSW 13 112348863 critical splice donor site probably null
R6994:Ankrd55 UTSW 13 112368300 missense probably benign 0.42
R7100:Ankrd55 UTSW 13 112356110 missense probably benign 0.00
R7247:Ankrd55 UTSW 13 112336253 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGATACCAACTGCCAAGGTCAGC -3'
(R):5'- CCTCAGCCCATTCAGGGTAGAAAAG -3'

Sequencing Primer
(F):5'- TGTCTTTAAGAAGAGGACCTCG -3'
(R):5'- CTAGCTTAACTCTACAAGTGTGAGG -3'
Posted On2013-06-11